>DTA_28_1_Mno length=2532;Class=DNA transposons;Order=TIR;superfamily=hAT; GGAAAAAAAATTGGAGGGAAAAAAATGAAGCAGAAGATAGTGAAGCCGGTTGCCTCAACTGCAATCTTGTAAAGGTTCTG TGGTAATTTCCTTTTGTCTGAATTTTTTGTTTAAGCAATGGTTGGAGAGAGGGATTGAGGGAGAGAGAAAATGTAAGATC TAAAGTTTGCTCCTTTTTTTTTTCTTTTTTTTTTCTTTTCAATATAAAGTAGTTTAGGAAAAGTGTTAAAAGATGAGTTA CATTTCAGACTTGATTTGCTAATACATATATGTATATGTATGTTATTTCCTTTTTCTGTGATGAACTCGAAACTGCCGCT TTCTGTGCTGAAGTTGCGCTTGTTATATGTTTAAATACCTTCTCAGTTTGTGTTGTGCTGAGTATGCTGACTTTTTGTTT GATTTACTTTATCGGATTAGGAATCTGCTGGTGATAATTGCGTTCATTCTACCACTGGAAAACCAGCAAACTGACCAAAC CTGCTGCTGTTATGAGAAACCCAATTGCAGCACAACTAATGACATGGGATCTTTTCACAGGTACTGGAGGAGGTGGTTCT AGTAGATCTAACTGTAATGGTGAAAATTGATACTTTGTGGACCCATCTGAATATTCAATGTCAAGAATACCCTTATAGAT TGGAGGACAAAAGGAAGAATTTTTCTGATGAAGATAGCGATGAGGATAGCATTGAGGACGCAATTAGCCGTAACATTGAA GTGGATGAGTTTGAAGCAGAAGCAAAATATAGAGCAAGACAACAAGGACTTAGAGCAGCATTGGCTCAAATGATATTATA GACGCACTGCCATTTAGATTTGTGGAGGGAAAAGGGTTCAAAAGGTACTGTAGTTTTCTGGCTCCAGATTTTGAACTCCC GTCTCGAGCAGAAGTTGCTAGAGATGTCATGAAGTTGTATTTGGATGAGAAGAAAAATTTGCGGAGTTTATTATCCAGTA ATTCACAAAGGGTTTCCCTTACCACAGACATATGGACTTCCTCACACAATATAATTATATGTGTCTCACGGCTCATTTCA TTGACAGTGAGTGGAAGCTTCAAAAGAAGATATTGAGCTTTGTCAAGTTCCGGATTGCAAATAGAAAACAATTGGTAAGA CACTCGAAGTTTGTTTACTTAATTGGGGCATTAAAAAAGTTCACACGTTAACAATTGATAATGCAAATTCCAATAATGAA GTCATTAGCTATGTAAAAACAAGGCTTCGAGATTGGAATGGTTGTGTGTTGGATGGTGAGTTCTTACACATGCAATGTTG AGCTATATTATAAACTTGATTGTGAAAGAGGGGTTGAATGATCTTCATGATTCTATTGCTAGCATTGGCCATGCTGTTAA GTATGTTAGATCTTCATCTGCGAGGCTACAAAAATTTAAGGAATTCATAAAGATGGAGAAAATTCGATGCAAGGATCTTG TAGTTCTAGATGTGCCTACCTGGTGGAATACCACCTAGTTTTTGTTGGGAAATGCAATTAGATTTTAAAAAGCTTTTGAG AGGTTGGCAGAGGAGGATGGACAATTTTTGAGCTACTTTACGGTTGACGAAGATGGGGAGAAAAGGATCGAGCCCCCTTC CTTGGAGGACAGGAACAACGTTAAGGCTTTTGAAGTTACTCGATGGTGCCTCTTTGAAGTTCAATGCTTCATTTCATGAT ACATCCAACACTATTTTGGAGAACTCTGTGAAATCCGATATCATCTGAATGAGTGGAGTCAAAACGAAGATTCTACATTG AGCAACATAGCTGGCAACATGAAGGTAAACTATGACCAGTATTTGGCCTAAACTAACAATATCAACCCCTTGCTGTTCAT TTCGCTTGTGCTTGACCCACGATACAAGATGGAGTTCCTGAAGCATCGTTTAAATCTATGTTATGATGATTCGGCAGCAG AGATGACAAAAAGCGTTGAAGATACTCTGAAGCTTTTGCATGAGAATTATAAGACTCAAAGTTCCAATGACAGTCAGACA TCAAGCAGGATGGATATGCATTTGGAAAGTTAAAGAGGACGGAGTGGTTTAAAGAGAGGGAACGCCTGAATATTGAAACT GAGGTTGATAGATACTTATTGGATCCTAGAGAGGATCTGACTGATGATGAATTCGATTTATTAGCGTGGTGGAAATCAAA TTCTCGCAAATGTCCAAAACTGTCGGAGATTGCACAGGATGTTTTAGCTTTTCCGATATCTACCATAGGCTCTGAGTCTG CTTTCAACATTGAAGGTCGGTTTCTTGACACTTACCGTAGCGCATTCAGTACGTGTTCTCCGATGGCACTGGAGGCCTTG CTATGTACCCAAAGTTGGTTAACATCTACACCTGCTCCTCTGGTTTTCCGGGAGTATATTGATGATTGGGACAGATATGA AGAAATTGAATTTGGTACGATACAATATGCAATTTCATTTATTCTTTTTTTAAATTTTCTCTTCCCTTGTTTTTTAACTG ATTGGTTACTTTCTTATTTTCTATATTTTCTTCCTTTAGAGCTTTTGGAACA