>DTA_27_1_Mno length=6232;Class=DNA transposons;Order=TIR;superfamily=hAT; AAAGTTCCACCACTACTTTGGAGTATGAATTTCACACAGCATTCCCATTTAAGCTTGAGTCATACGATGTAAATGAGATA GTTTTGTGGATCCAATCCACGCTCGTTGAACTCTAGTGGGCCGTGATTTGGTGGCCATGAGTAAGGAAATGGCTCATTCA TCTTTGGTCCAATTTAGTGTTAAATCCCACTTGGGGGTTTTAAATTAATTGGTCAAAAGTGGATGTGCCCAATAACCTTT CCTCTCACCTCTAATAACCCAAAAAGACCAACGTCCATGTTTTAGAGTCTCTCTTACCTAGAAGACAAATTTCCCATTAT TTAAATAGTAAATAAAGGTAACAAGTATGAATCAGACATGTCTCTAAAGGTGAATGTAGTCGAGTGAACTCGGTCCCTTC AACGAGTCAATCATTAGTTTAGTCATGTACTACTAGCAAGAATAACCGAAAGCAAGTACTAGTAATGATTTACATGAAAC CCGGCCGGGTAGTACTCATGAAGATTTGATCAAAGAGGACATAGACGTGGTGGATATCTTGCCCTGATTGAGATTTACTC TCTATAGCACCTAGGTGTGCTTTTAGTTTGTTTCTTTCCTATTCCTCGGGTTGTGTTTTCTTTGGTTGTTCTCTATCTTC TTGATATTGGCGCTGTTTTGTTTGATGTCTCTCTTTGGGCTTCCTTAGACACTATAACTTCAGCTTTGCTCCTTTGTCTC TCGTTTTGGTTTTTCGGTTCCTTCTGCGGTTTCTGTTTGTGTTAGAAAGATCTTTCCCATTTCCTGCTCGGGGTCGTCTA AATGGGGACCAGCGATGACGAATAGCTTGATGAGCTGATTCGCCAAGCGGCTGCTTTGCATTGTGCTGAGGATGCACTAG ACCTTATTCCTGATCCGGCTCTTTCTAGAATCACCACAGCCACCAAGGCCATTAGAAAGGTAGCAAGGAGGAAGCAGAGT AAACTCATAGTCTGCAATGGAATGGTAACGCTTGATTGCCCATTTTCTTGATAAGAATTGGAAGTTGCATAAGAGACTAT TGAACTTTTATATTATGCCACCTCCACACATTGGTGTTGCACTATCTGAGAAGATGTTTGATTTGTTGAGTAATTGGGAA ATTGAGGGAAATATTTTCAATATCACTTTAGATAATACTGCTTTTAATAATGTCTCTATGGATGCATTGCAAAACTAATT GAACTTGTGTGGCTTTTACTACCTTACCATGGTGAATTCTCTCATTTGAGATGTTGTGCCGATATTCTCAATCTCGTTGT GCAAGAAGGTTTGAAATGTATTGATAAGTCAATGAGAAGATCGGGGATAATATTAAATATGTTAAAGGATCACAACTGTT AGGACTTTTGTTAGTTGGCAATTTTTGGTAAAAGGTTCTAATAGCTATGAAGATTCTATCTTTGGATTTTTGCACCAGAT TTGGAATGTTTGACATCTCTTGGGTTGATTCTTTCTATAGAAGAATTGGTTCTCTTTTTTGAAAAGTAATCTTTTGGGGA TATAATTGGTTGTATATGTGGTCATCGTGGAAAAAGGAAAGAAGTAGTGAGGGTGGCTGATTTTGTGCATTCGGTGGGGT GAGTATTTTGGGGTGATAGTGTGATGAACGTGAATGGTTTTGAGTAGAATAGAACCTACAGAAAAGTAGTGTTTCGGTGA TGCTTAATTGGTGATTGAACGATTTGGCTTTTTGAAGAAACTTGTATCGCTTTCAGGAGAAAGCTTTCGAAGTCGAGTGG CACTCACTGGACAAAGCCACTAAGAGGATTCTACACAGTGGCGATGACATCAAGGAGGGAGTCTTTGAGTGTGTAAGACC GATTGGTGATTGTAATTCTTTGAACTTAGTGGATTGTTCACTGTCTGGGCGTGGCCCCGCAGATGTAGGTGTGCACACCG AACTGCGATATCATTTTTGGTTGTCTTTCGTTCTTTTTTGCTCTATTTTCTGTTTATGCACGTTTTCAATTCATTGTCNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGATGGACTT TTTGAAAGAAGGTGGCTCAGTTTCGCGCCCTCCTCTCCTCGATGGTTCCAACTATGCCTATTGAAAAGCTCGTATGAAGG CGTTCATCAAAGCAATTGATGAGAAAGCGTGGCGTGCCGTTCTAACTGGTTGGACACACCCTATCACCAAAGATGATGCT GGAAAAGAAGTATTGAAACTCGAAGAAAAGTGGTCTATGGAAGAAGATTGATTGGCCAATAACAACTCAAGAGCATTGAA TGTTATTTTCAATGGAGTTTATGCCAATCAATTCAAGCTCATTTCAACATGCGAATCCACAAGGGATGCTTGGGAGATTT TACAAACGTCACATGAGGGTATGGCTGCCGTGAGACTATCAAAGTTGCAAATTCTCACTACAAGATTTGAGAATCTTCGT ATGCTTGAGAATGAAACAATTTCAGATTTCAATTTCAAATTGTGTGACATTGCTAATGAATCATTTGCTCTTGGTGAGAA AATTCCTGAGGAAAAACTGGTGAGGAAGGCATTAAGATCACTCCCTCGAAGGTTTGCTTACAAAGTGATAGCTATTGAAG AGGCCAAAGACGTGCGGTCAATGAAGCTTGACGAATTAATGGGCTATTTGCGTACTTTTGAGATGAACCTGAATGAAAAT AAGAAGGAGAAGGAGAAAAGCATTGCTTTTCAAGCCGAAGTTGAAGAAGTTGAGTCTGATGATGAAAAGGACTTAACTGA GTCCATAGCACGATTATCGAAGAATTTTAACAAGGTGATGAAGAAGTTTAATAAGAAGAACAAAAATACAAGCTATGACA ACTTTAGCAATTTTCAAAAGAATAAAGCTGCAACAAGTGGTACTGATTTCAAGACAAACATAGGTATTCAATGTCCGAAT TGTGATGGATACGGGAACATTCAATCTGAGTGTGCCAACACTCTAAAGAAGAAGAAGAAGAAGTCTCTGAATGCAACGTG GAGTGATGAAGACTCTAAAGGCAGTCCGGAGGATGAAGACCATGTGAGTAACTACGTTGCTTTTTAATGTTTATACTGAT CAGGATGATGTTTCTATCAGCAGTGTTGCAACACTGCCTGTAACAGATTCTGTGAATAGTGAAAACGAAGGAGATTTTTT AGATTCTGAAAGTAACAGTGATGGTGAGGAGTTTACTATTGATGCCATACAAGAATCCTATAAGACCATGTTCAGTAAAT GGGTTAAAGTGTGTTAAATAAATAAGTCTCTACGAGAGCGTGTCAATGAGCTTATCAAAGAGAATGATGTGTTGAAGAGA GCTGTTGATAATTATGAATTCCTTGCTACAGAGAGAGAAAAGAAGCTGAAGGAAACAAAGGCTGAATTGGAGAGCACCCA GAAAAATTTGAAAATGATGAATTCTGGTACAAATAAACTGGAACATATTCTTTCACTGAGAAAATCAAGTGGTGATCGTC ATGGCCTTGGATATACTAGGGAGAGCTCAACATCCAAAACATTGTTTGTGAAGGAGACGCATGTCCCTAAGCCTCCGACT ATCCCTAATAAAAAGGTTATCATTTCACCCTTTCAACGTAAAAGATTTGTTCTCATATGCCATTATTGTGGTTTACCTAG CCACATAAGACCAAGATGCTACAAGTATTTAAATGCTTTAAAAAGAAGTATGATCATTAATCCACCAAATTTCGCATTCT TAAGAAAGACACATAAAGCAAAGATTGATGTGCAAGACAAATTTCCTAGACGTGTGTGTGTAAGGAAATTTGATTTGAGG TGTCATAGAGTCTATACTTCTTTAGAAGCATGTACTAATGATTGTGGGTGTAGTAATGTTGGTTGGTCCAAGCATTTGAC AGGTGATAAGAACAAGATTCATAGAGTGTTGAATTCAGGAGGAGTAAGATAGAGAGAAGATTCAGGGGGAGAGATTTGCA GAGATCAATGACCCTGAAAGATAATCTGCAGAAAAGTGTTCTATCAGGTGTTGCAACACTTTCTGCGACAACAACTTCTA GAAGGTTTTTCTATTAGTATTATTTTTACTTTTGGCTATTTTTTGTCTTGTGTCATATGTAATCAGTCAAAGAACAATTT GTTTTTTTGAATTTCTTGTCATAGGTTCTTATGTTAGTTTTGCCAAAAATGCCAAAGGGGGAGATTGTTAGGACTTTTGT TAGTTGGCAATTTTTGGCAAAAGGTTGTAACAACTATGGAGATTCAATCTCTGGATTTTTACACCAGATTTGGAATGTTT GACATCTCTTGGGTTGATTCTTTCTATAGAAGAAGGCAAGCTTTTTGAGAATGTAATTCTAGAAGGTTAACTTTGGTTAT GTGATTGGTTCTGTTTTTTGGAAAGTATTCTTTTGGGGATGTAATTGGTTGTATATGTGGTCATCGTGGAAAAAGGAAAG AAGTAGTGAGGGTGGCTGATTTTGTGCATTCAGTGGGGTGAGTATTTTGGGATGATAGTGTGATGTACGTGGATGGTTTT GTGTAGAATAGAACCTGCAGAAAAGTAGTGTTTCGGTGATGCTTAATTGGTGATTGAACGATTTGGCTTTTTGAAGAAAC TTGCATCGCTTTCGGGAGAAAGCTTTCGAAGTCGAGTGGCGCTCGCAGGATATAGCCACTAAGAGGATTCTACACAGCGG CGACGACATCAAGGAGGGAGTCTTTGAGTGTGTAAGACCGATTGGTGATTGTAATTCTTTGAACTTAGTGGATTGTTCAC TGTCTGGGTGTGGCCCCACTGATGTAGGTGTGCGCACTGAACTGCGATATCATTTTTGGTTGTCTTTCATTCTTTTCTGT ACTATATTCTGTTTATGCACGTTTTCAATTCATTGTCCACTGATTATCTCTGAACATGATAGTTGATTGCAGGTGTTGCT AAAAGTGTTGTAACATTCTTTCTAACACATGCGTGAAAACAGACCTAACAACAACAAAGAAAGTAAAAGTTTTTAGAATG TGTTGAGTTGGTATCGATGGAAAGCAAGAAAGGATTGTCTCAAGATGTGGTTACTAGATGGAACTCAACTTACCTTATGC TTGGCAGTGCTCTTTTTTATCGATGTGCTTTCTAACATTTTGAATTAAGTGATTCTAACCATAAGCGTTGTCCCAATACC AATGATTGGGAATTTGATAATTATTAAGTGCTTTCCAACTTACCTTATGTTTGATAATTATGTTTAGGAATTTGATGATG CTTCAAGTGATTCATCTTATGCTTTAAACCAAAAATAGCAGTTAGAATTGTATTTGGATGAACCTAGAATGAAAAGGAGC TATCAGTTGGATATCCTCTCCTATTGGAAGACAAAACAGTACCGATACCCAATCCATTACTGCCATGGCTTGTGATATCT TAAGCATTCATGTACCAATAGTAGTTTTAGAGGCCGCATTTAGTGTTGGCAATCGTGTGCTTGATCAATTCCATAGCTCT CTTAAGCATGACACTGTTGAAGTAATTGTGTATAAGAGATGGGTTGTATGGGAATGAAGGTATATTCTTCAAGTTCTTTA TTATTTGATTACTTAAATATTGTTACTCTTATAAATACTAATTATTTAAACCTTTTTACCTAGATGGAGTCAAAATACTT GATAAAGATATGGAGGAGCTCATAAAAAATGTGGTGGATCTTAACATAGATGAAGTGAAAACTGTTAACTAAGCTTCTAA CTTTGGATGTGCTTGACTTAGGTCTTTATTATCATTGTGTAATGGTGTTTTGCTTGATTTGAACTCTGTGGTTGTTGGGA CTTTGTTATGTAAATTCGATGTGTTATTTTCTTTTGCATGCATTTAAATTTTGTTGTTGTTAGAACTTTAGTATCTAGAT TTGATGTGATGAGCTATGTTATATTCTAGTAGTATTATGGCATTTTGAGGTTGGGCTTGTTATTAACATATTTGCCTATG GTATGGTCGAATTTTTGTTATATTGATATTGAGCATGTGGTTTTATCTGATGATATTTTTTTATGAAGTATGAGCTATGA TATTTATTAAATATTATTATTTTACTAAGATTTTATCAATTATTGATATTTTTAACAAGTTATAAACAATAA