>DTA_26_1_Mno length=4948;Class=DNA transposons;Order=TIR;superfamily=hAT; TAGGGAGGGCAATATAAGATAACACGAATAGAAATTGACACAAAAATTACGGGTTAGGATTGAGAAAATAATGACCCGTT CACTTCGTCGATTCGAGTTTTGCTACAGTAAAAAATTATCAGAAACAGTCACATCTAACTTTTTTACTACAGTGAAAAGC TCTCACATAACATCACATCTTAACTCGAATCAACGAACTAAACGGATCCTAAGAGTGCGGGTCGAAATTGAGTCGACTCG AATTGGGTCAGAATCAGGTCAATTTTCGAGTTAAACCTGTACAACTTGAAAACGACATGCAATTCAATTTCGGGTCCAAC CAGAAACGAACACTTAGGCGATGTTTGGTAAAGGGATTCGTTGCCTGATTCGAATCATGATTCGTGGTTCGCTACAGTAT TTTTTCTCATAAAAAATTCACGTAAATCGAAAATGATTCGAATCACATGGTTTGAATCCTCCAACCAAACGTCCTCTTAA TGACCCGTAGGAAAAAAAAAATATATATATATATATATAATATATATACTCACACACAGGCAGCCACTTAGAGTCAAGTC TTAGGTCGTTTAGTTTATTGATTTGAGTTTTTAATTCGAGTTGAGATGTAATTTTATGTGAAATTTTTTTGTTGTAATAA AAAAATTAAATGTGATTATTTTTAAAAAATTTTTTACTGTAATAAAATTCGAATCGGTGAAACGAACGGAGAGATCACCT ATTTTCTATTTTCTGTAAAGATTCTCAGAAGAGTACCTTACCTCTTTCTTAAGTCCTCTCCCTCGAAATATCTACCTATC TTAAGAGCGCTCCCTCGCTTTATATTATTGAAAAGGCGCATAAATTGGATTTTTTCCTCTTCTCAACATCTTAATGTTGC GCCCCTATCAATTCACATTGATAAATCAATTTAGGGAAACGAAAATTCCTATTAGATATAATACTGAGTCAACAGGAGAA CTACCCCTATTCCGACTTTTAGACGATAAATCCTAAAAATTAGAATCACCCAGTCCCATACTCCCTCTTCTGCCGCCTCC CTCTCTTCTTCCACCTCTCTCTCTTCTTCTTCTCCGTCCGCCATCTCCTCCGTCCGTCGCAGTCCTCCGTCCGAAGTTCT CCTCAGTCCGTCACCGATCTCCTCCTATTCTCTTCTGTCGTTGATCTCCTCCGTCTGCCGCTCTCCTCAGTCCGCCAATC TCCTCAGAGATCCCATTAAAGCCCAGCTCAAGGTTGGAATCAGGAATCCCTTGTTTTTTTCCATTATTTTCAACTTTCGT GATCTAATATTCGCGGTTCTTTCTGGGATTAGTTCTGCTTTGATTACATGTGAACAATCTGTTGTGTTAGAGATTTCAAA TTCAACTTCCGTGATCTAATATTCTCGGTTCTTCTGCGACCTAACATTTGATTTTTTTTTTTTCCGGTTTTTTGCTTGCT TTTGTATAGTTTGCTGCAGATGATTGTTACTGACATATATTTGGACTATGCATATATATGATTCTTACACAATTAAAGAA AAGAAGAACACGAGTGAGCTTACTACACAAACGTCACAACTAGAAACAAAGTCTGTGGACTAACGAGCCTCAAAAGGAAG TGAACACTTGTATATTAGCTGTGTTACAGATTATATTATTACAAGCCATTGAGCACAATTTAGAGGAAAGGCTTAACTCT TGTTTACTAAAACATCAGTAGATCATATTGCAAAAATGTTAAGCAAAAGAAAGAATTTTAAAAACTAGTTAATGAAATAT TTGTCATAGTTTTTGAACACTTGTATATTAACTGTGTTACAATTATATTATTACAAGCCATTGAACACAATCTAGAGGAA AGGCATAACTCTTGTTTACTAAAACATCAGTAGATCATATTGCAAAAATGTTAGGCAAAAGATTAAATTTTAAAAACTAT TTTATTTTGTTCTTTTACTGTTGTATTTCTGTTACTATTGTAGTTGTTATGTTCTTTTTTTTTCCCTTGTAAATTGAGTT TTTCCTTAAGTCTATTGTAGATGAACAACAATGATTTGGAGGCACAAAGTGAGAACATTGATTTCGATGGAGCAATAGAT GTCGATATCAAACTTGAGGAGGATGTGGTTGAGCTCACAGGCATCGGTGGCCAAAAACCTCTCAAAAAGAAGAAGTTGAA ATCGAAAGTTTGGAACTTTTTTGACATCCTTCCTCTTGGCCTGGACAAAAAGCTTAGGAGTGCTTGCTACTAGTAAGTAT GGAAACAGGTAACATGTTGAAGCATATTAAAACTTGTCTGAGATCAGACACAAGAGATATTGGTCAAATGCTTATTTCTC GTGATAGTAGCTTATTATTTGGTTCTTGTTCCTTTGATTCTGAAAAATGGCGTGAGTTGATCACTGCTTGTATTGTTATG CATGATTTGTCTTTCCAATTTGTTGAGTACAAAGGATTAAGGGCTATGCTTCAATATCTGTATCCTGATGTGGAATTAGT GTCTAGGAACACTGCTAAAGTTGACACTATTAAGTTGTATGAAAGGGAGAAAACAAAAATAAAGAATATGTTGGATGCAT GTCCTGGTAGAATAAGTTTGACATCTGATTTGTGGACTTCATTGACTACTGATGGATATTTGTGCCTGACTGCTCATTTT CTTGATAAGAATTGGAAGTTGCATAAAAGAATCTTGAATTTTTGTCTTATGCCACCTCCACACATTGGGATAGCATTATC TAAGAAAATCTTTTCTTTATTAAGTAATTGAGGAATTGAGGAAAAGATTTTCAGTATCACTTTAGATAATGCTGATTCGA ATGATGTCTCTGTGGATGCATTACAAAACCAATTGAACTTGCGTGGTTTGTTGCCTTTTCATGGTGAATTCTTTCATTTG AGATGCTGTGCTCATATACTTAACCTTGTTGTGCAAGATGGTTTGAAAAGTATTGATAAGTCGGTTAAGAAGATTCAAGA TAGTATTAAATATGTTAAAAGATCACAACAAAGGAAGCAAAAGGTTTTAAAATGTGTTTAAGTTGGTATCGATGGGAAGC AACAAAGGATTGTCTCAAGATGTGGTTACTAGATAGAATTTGACTTACCTTATGCTTGAAAGTGCTCTCTTTTATAGACG TGCTTTCCAACATTTGGAATTGAGTGATTCTAACTATAAGAATTGTCCCAACTCCGATGAGTGAGAAAGAGTTGAGAAAA TATCCAAGTTTTTGAAAGTCTTCTATGATGCCACACTTTTGTTTTCTGGCACTCACTATCCCATAGCAAGCTTGTATTGT CCAGCAATTATGGAATGTTACATAACCCTGAAAAATGCTACCCAAGGTGGAGATGAGTACTTAAACTCCACGGCTATGCA TATGTGGCCAAAATTTCAGAAATATTGGTCACAATTCAGCTCCATTTTAGGCATTGCACTTGTGTTTGATCCTCGGTATA AGATGCAGTTTATTGACCTTTGCTACAACAAAGCTTTTAGGCATAACTCTGAGGAGTTGTTTTCTTTGCGTGAGAAGTTA GAATCCCTTTTTGACGAGTATGCTTTGAAGCTTGATCATTCTACCTCACCATCCACTTCCAAGAAAAAGGACAAGAGTAA AGCACCACATAGAATAGAAGTACATGAGTCAGATTTGTTGAAGGTAATATTTACTTTTCTTATATATTTACATTATTTTA CATAGAAATTAGTATATTAGTTACTAATGTTTCATATTTTTTTTCAGGAATTTGATAATGTTTCAAGTGATTTGTTTTAT GCTTCAAACCAAAAATCACAGTTGAAATTGTATTTGGATGAGCCTAGAATGAAACGGGGGAATTGTATTTGGATGAGCCT AGAATGAAATGGAGTTATCAATTGGATATTCTCTATTATTGGAAGACAAATCAGTGTCGCTACCCAATTCTTGCTGCCAT GGCTCGTGATATATTATGCATTCATGTATCAACAGTTGCTTCAGAGGCTGCATTTAGTGTTGGCGGTCGTGTGCTTGATC AGTTTCATAGCTCTCTTAAACATGATACTGTTGAAGCAATTGTGTGTACAAGGGATTGATTGTATGAAAATGAAGATATA TTCTTCAAGTTCTTCATTGTTCTCTTAAATATTGTTATTATCAATCTTATAAATGCTAATCAATTCAACTCTTTTTCCTA GATGGATTCAAAATACTTCATCAAGATATGGATGACCTCATCAACAATGTGGTGAATCTTAACATACATGAAGAAAAAAA TGTCAACCAAGCTTCTAACTCCGGATGTGCTTGAATTTGGTTTTTATTATGGTTTTGTGTCAATTTCGTGTGACATGTGA TGTAGGTTGTTGAACTATGTGGTTGTTGAGACTTTGTTATGTAGGTTTCATGTGATGTTTTCTTCTGCATGCATTTAAAC TTTGTTGTTGCTGAAACTTTATTTTCTAGATTTAGGTTTGGACTTTGGTGTTGGAACTTTATTATCTATGCTTGGACCTT GGTGTGAGTCTTATGAACTATGTTTTCTAGTAGGATTATGGTATTTTGGGGATTAGACTTGTTATCATATTAACTTGTTT GCCTATGGTGTGTTTTATTATTTTGGTGTTGATAATGTTTTCTTATGAATTATGAGCTATGATACTTTGTTAATTGTTAT TATTTTAGACGGATTTTATCAATAAATGATATTTGTAACATGTTATAAACTTTAATATATGTACAAAATGTATTGAAATC TACAATTTCATGTTAATTTCGGTTCAACAGGTTCGTGTCGTGTCTCGGGTTCGCGAGTCAATTTCGTGTCGCGTGTCACT TTCGATTTGTGTCGTGTGAACTTGCAACCTGACCGTGTCGTGTTCGTGCCGGCTGTTCTCAATTTTTTCGTGTCGCAGGT CGTGTACGGGTGGCATTAAAAAAAATGACACGGTACAAACACGACACGAACACGAATTGACACCCTTA