>DTA_25_1_Mno length=2579;Class=DNA transposons;Order=TIR;superfamily=hAT; CAAAATATATGTGCTCATGTAATGCTTTAGAGGTTCATTAGGCCTTCGTTTCAATTTTTTTGAGTCTTCTTTTCTGTTCT TGTAAGTATGTATGATTGATGATCTAATTATTTTTAAGGATGTTCTTTTCTGTTCTTGTAAGTACTGATTTGCGAAAGAA TTTAGGCTTTTATTTGTAAGGATGTTCATATGTTAATTAAATTAAAGGATTCTCCTGTTGTGCAACTCTAAATTCTTGAT ACATCTCAATATATTTATTCATTCTCTATATTATCGATGACTACTCTAGCTGCAAATCTACATTTTCTTTCAATTGTTTG ATTACTTGGTGGGTGGTATAGTTGTCATATGCGTTTGGTTACAATGAGCTCTGCATGCAGCTCTATAGTATTTTCCTCGA GAACAAGAGAGTAATTTATTCTTAGTCTAAATTTGCTTTTATTATTTTGTAGAATTAATGGAGTCATCAAGTATTAATGA GGAAGTGGAATTTATGCCGAGTGCTTCTAATCATGGGGCTGAGAGTACTTATCAAGTCGTAGAGGAAGATATAGTTTAGG AAGGAAGAAAAAGAACTTGCAATCTGTTGTATGGGATCATTATGATATAGAAAAGATTAATGGGAAAGAGAGAGCAATTT GTAAGCATTGTGTGAGGATATTGGGAGGAGAAAGTAAAAATGGTACAAGCCATTTGCATAAACATTTGAGTAGATGTCCT AAGTTGAAAGGAGACACAAATAAAAGACAAAAGAGAAGTGGTGGGACTCCTTCAATCGGTGGATACAATTTTGATCCGGA GTTGCTTAGAGAGAAAATAGCCATATGATTATTTTGCATGAATATCCTTTGAGTATCGTGGAGCATGTTGCTTTCATTGA AATGATGAGCGTTGCATGCCCCATGTTATGATGATGTTGAGAAACACCATTAGAAGCGATATGTTTAAGATATATAAGGA AAAGAAAGAGAATGCAATGCAGCTAATGGAGAAAAACTCAAGTAAAATTGCTGTTACAACTGATATGTGGACAGCTAACA ACCAGAAGAGAGGGTACATGACTGTGACAGGACACTTTATTGATGAATCTTGAGTTTTAAGATCCCAGATTTTGAGTTTT CAACATCTTCCATCTCCACATGATGCTCCGACATTAACTAATGCATTGATTGATTGTTTGATGGACTGGAATGTAGACCA CAAATTGTCTACATTGACAGTAGATAATTGTACGACAAATGATGCTATGATTCCGCTTGTAAAGGAGAAGTTGTCTGGTG GTTTGCTACTTTTGGATGGGAAGTTATTTCATATGTGTTGTGTGCATATTTTGAATCTCATTGTGAAGGATGGTTTAGAG GTTGCACTGAGAAAATTTGTGAAAGCGTTTCTTACTGGTCTGGGACACCAAAAAGAATGGAAACATTTGAGGGGGTTGCT CGTCAATTGAAGATACATAGTACAAAGAAGATTGCCCTCGATTGTCCGACTAGATGGAATTCAACCCACACGATGCTTAG TGTTGCATTATATACAAAGATTGAACAACACAATTCTCAATACAAGTCGGTGCCTTAAGAGGATGATTGAACCTTGGCAG CAGATTTATGTGAGAAGTTGCACTTGTTTTATCAAGTGACTGAGCTGTTTTCAGGGATAAAGTACCCCACAACTAATCTT TTTTTTTTTAATTTTTTATTCTGAAGATCTGTGAGATAAAAATGTCAATTTGGAATTGGTTGGCTTCAAATGATCCTTAC CTCAAGGACATGGCAAGTGCAATGATGGATAAATTTGAGAAGTATTGGAATGAAATCACGGAGTGATGGCTATTGCAACT GTTTTGGATCCGAGATTCAAGAATTGCCAAATCAGTCATTACAAACTGCTTATGAATCTAGGATAGGAATCAAATCCAAC AAACATTTGAAGCACTAGAGAAACAAAAGCAGCTAGTATATGGGCTACAAAATTCCTGAAACAAGAAATATAACTAACAG AATCACAAGAAGAAGCTAGAGAAATTTGATGAAGGATATCATCAATCACATTTGAGTCGGATGATCGCAGCTTTCGCTTA CTAACAGCGTGCACCACATTCACTGCATCAGTCTCTACGACTTAATTGAGAAAGCCATTTTCTACACATTATTGAATTGA AAATTTTAATTATCAGTTTTTTAAGGATTGAAATGAATCCTTATTTTTAAAATACTACTTGTTCTGTATATTTTTTTAGG ACATACCTTTTTATTCACGTATGATGTTACATAATTTTTTGCTCACCTTCTTTATATCTGTGACCAAAAGGTAGGGAAAA CTTTTGTCACTTTTTGTTATTATTTGCATTTATTATTTGACACGTGGACTTTACTAACATAATATATTATTATTTAAATA AAAAATAAGATAATGGAGTCTACATATCAAACACTGAATGTAGATAGTGACGTTAACATTTTTTTGAAGGAAAACTGTAT AGAGAGTCCACATCGGCCAATAACAGAGCCATGATTTATCAATAAGGGGGGTTAATTTTTTTTAATCAAGATTATACTAA TATATATATATATATATAT