>DTA_24_1_Mno length=7594;Class=DNA transposons;Order=TIR;superfamily=hAT; CTATTCTTCACATTTCTCTTGATGCACCGTGAACTTGAGCCCATGACAAAAGGACTTTTTTTGTTTAAGTTAGGACTTAG GATGAGACAACAATGAATCGTGAACCATTTTTTGGGTTTAATGTGTGGTTTTTTTTTTTTGTTTAACAATAGTGAACCGT GAACTGTGAAGAATAGGTTTTTTTTTTTGTTTAACAATAGTGAACCGTGAACTGTGAAGAATAGGTTTTTTTTTGTTTAA CAACAGTGAACCGTGAAGAATAGGTTTTTTTTTATTTTGGTTTAACGTGTGGTTTTTTTTTTTTTTTAAGTTAGGATGAA ACCTCCACAAAATGACAGCCGTAGTCGTAGTGGGAGAAGGGACCCGGCTTGGAAATATAGAAAAGAAATTACAAACGAAA ATGACAAAAAAACTTATGTTTACCTCCAATGTGTGTTTTGCAATCAAATTATTAAAAGAGATGTTAAGAGAATGAAAGAC CACCTTGGTTTCACTCATAAGAATGTAAAGCCTTGTCCTAAGGTTCCTGATGATGTGAAGAAAGAAACTAATGACTATAT GAACAAGTGGGCTGCTAAAAAACAGTCAACGCATAAAAGTTTTGAAGAAATGGTGGATGTTGGCTCTTATTTTGGTGATG GATTTGTCGACTCTTGTCAACTGCCGCAAGTGGTTAGTTATAGAGGAGTTAGAGTTCCCATGGACAGGTTTTTGAACAAT GTGGATGATAAGGAAGCAAACGAAAGACCTTCCCCTAGAACGACATCAAGTGAGAAAGAGGCCCGTTCTCGAGTATGTCT TGATTTTGGTAGGTTCTTTTATGAAAATGCACTTGCTTTCAATATTGCTAGGAGCCCCTCCTATTGTAATGTGTAGATCA ATTGGCAACTATGGTAGAGGTCATGTACCCCCAAGTATGCATGAGCTTAGAACATAGATTTTGAAGGAGGAAGTACTTAC TACTGAAAATTTTGTGGAGAAGGTTAAAATGACTTGGAAACAAACAGGAGTTTCTATTTTATCTGATGGCTGATCGGATG CTAGAAATCAAGGTTTGATCAATTATTTAGTCAACAATCCTCATGGAACTATTTTTTTGAGATCTGTTGATGCCTCTGAT AAAAAGAAATATGCAAATCTATTGTTTGAGATGCTTGACGAGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTCAAGT CGTGACTGACAACGCAAGTGCTTATAAGGCTGCTGGAGCAAAACTGTAGAAAATCTTCTAGAAGTTAGTTGTATTTTTAT TATTAAAGTAGCCGTGTATATAGAAGTAAAGTAGGGCTGATTATTAGGCAGATTCTTTCCTAGTTTTCAGGGATCTTAAC AACCTAAGATCTCTTTTTCATGTATATAAATATTTGGTCAGTAAATGAGAAAATTACTTCTTCTCTTCCAAAATATTCTA CATGGTACCAAAGCCACCCTTTGTGCCCTAAATCTGCCGTCATTCTCTATGCCCTAAACCTGCCGCCGCCGTCCCTCATT GTCTCTCTATTTGAATCCTCACACCGTTGCTCCTTTCTCCTGCTCTCAATTTTTTTTTCCCTTCTTGCCTTCAATCATGA CTGAAACAGATCAGTCCTCCTCGACCAGTATCACCTCTCCATCTGGTTCATCTCCTGCACTCACTTCGGCTATGCCTGAG AGCAATCTGATTCTTGTTACCAGTCATAAACTGAATGGTCACAATTATTTGCAATGGTCTCAATCCGTAATGATGTTCAT CAGAGGCAAGGGTCGTGATGATTATCTCACTGGAGCAGCAGCCCCACCTGACAAGTCCGATACCCGCTACAAACTTTGGC GCTCCGAAAATAACATGGTTATGTCCTGGCTGATATGTTCCATGACCACAGAGATTGGTGAAAATTTTCTTCTTTATTCC ACGGCACGAGATATCTGGGAGGCCGCTCAAGAAACATATTCCAACAGTGAAAACACCTCGGAATTATTTCAGGTGGAAAC TGCACTTCAGGATCTTAATCAAGGGGAGACAACTGTCACCACCTATTTCACCAACCTAACTCGGAACTGGCAGAAACTTG ACTTGTTCGAAACCCATGACTGGAAATGTCCTGATGATGGTGCCAAATTCAGGAAAATAGTGGAGACAAAAAGGGTCTTC AAATTCCTCATGGGACTTAACAAATCCCTAGATGAAGTTCAGGGTCGAATCCTTTCCACCAAGCCTCTCCCTAGCCTTCG AGAGGCCTTTTCTGAGGTCCGTAGGGAAGAAAGTCGAATAAAAGTAATGCTGGGAAAATCAAGGGCATTGTCAACTCCAA AAGGTTCAGCCCTTGTGGCTAACGGTTTGCTACCATCACAAGAGGATGCCTCAGTCCAGGCTCATGCTGCCCGTGGTCCT CCACATTTGAGGGAGACCTTGGTGTGATCAATGTCGAAAACCAAGCCACACCAAGGACACCTGCTAGAAAATCCACAGAA AACCCGTGGACTGGAAGCCTAACCGGTGGTCTGCTGAGCATGAAACCCGTGGGAATACAGCCTCAACAGAATTCACTGCT GCGTCCTCTCAAGCTCCATTTATCAAGGATCAAATTGAGGTCCTTCAGAGGCTAATTAGTCAAGCAAATACACAGCCAGC TCCTACTATTATTGGTACAGGAGCAACTGCTCACAGAGGTAATATATCTAGTGTTTTTGGTGCAACCAGGACACTCTCAA ATACATGGATTGTGGACTCTGGTGCATCAGATCACATGACTGGAAATAGGTCTCTGCTCACATCATTTAGTCCATGCCGG AGCCATCTCACAGTCCGTGTAGCCGATGGATCATGTTCCAAAGTTGCTGGAATTGGCACTGTTAACCTATCCCAGAATCT TGTCCTACATTCAGTCTTATTTGTGCCTAATTTAGACTAATTTACTGTCTGTGAGCAAGCTTACTAGTGATTTGGACTGC GTTACTAAGTTTTCTGCCAAAACTTGTGTTTTTCAGGATTCGGAATCGGGGAGGATGATTGGCAATGCTGAGCTTTGTGC AGGTCTCTATCTAATCACGATAATTCACAGGAAGGAAAAAGTTGCAGCAAAGTCTATGTCAGTCCAAAAAGTCAGTTACC TAGTATGTCCTTGTCTTCGAGTCTGTCCAATAAGGATAGTGCTGTTATGATGTGGCACTACCGTCTAGGTCATCCAAATT TTTTGTACCTTAAACGACTATTTCCATCATTATTTATCAATAAAAATTCAAGACTCTTTCATTGTGATATTTGTCAATTA TCTAAACACACACGCAGTTCGTATTCACCTCGACCATACAAGTCCTCTCATCCTTTCTCACTCATACACCGGGGCCTGCT GGTTTCTATTATTTGTTGATGATCATACACGCTTAAGTTGGGTGTTCCTAATGAAAGACAAATCTAAAACTACTCAAATA TTCAGAACATTCCATATCATGATCCAAAATCAATTCAAAACCAACATTCAGGTTTTCAAAACAGACAACGCCCGAGATTT CTTCAATTCGGTTCTTGGAGAGTATTTGCAAAATCACGGTATTATTCATCAAAGTTCGTGCGTTGACACACCCCAACAAA ATGGTGTAGCCGAACGAAAAAACCGTCATCTTCTTGAGGTTGCCCGCTCTTTATTGTTCACCTCAAATGTTCCCAAAAGA TTCTGGGGTGAGGCAGTTCTCACCGCTACTTATCTCATAAACCGCATGCCCTCACGTATCCTGAACTTCAAAACTCCAAG CCAAACATTCCTCGAAGTTTTTCCAAACTCTCACCTTATCACTCAAATTCCACTCAAGGTCTTCGGCTGCCCTGCCTTTG TCCATGTCCACGCCCAAAACAGGGGGAAACTAGATCCTAGAGCCACCAAATGTATCTTTCTTGGCTACTCACCAAACAAG AAGGGGTATAAATGCTACTGTCCACTCACAAACAGGTTCTTCCATTCCATGGATGTCACATTCTTCGAGCACCAATCATT CTACACCAATTCCTCTATTCAGGGGGAGAATAGAATGATGGAATCTCATAATTGGGATTGGGATTCTCTGCTCGAAAATG ATTCAGGGAGTTCCAGAATTCCAATCCTAAGTGCCTCGACTCCACCAGCAGAAACAATACAACCCCTCTTCACTGAGTCA GCCGAGCCTCTCCTCATTGAGTCAGCCGAGCCTCTTCGTGTCAACCCTGAAACCCAAACCGGTCAAGAAAAAGGTTCCAG CCCTGTCCCAAATGAACCCAGACCTAGTCAAAATCAAACTGCAACAGAAAAGGACTTTAGTGTCTACTCAAGGAGAAAAC GTCCTCAGCTGGAACCTGCACAAACTCAGCATAACCAAGACTCTTCCTCGGCTCCAACCTCCATTGAAAATACTCAAGGT AAGGCTGAAATTACTCTTGTTCCTGTGCCTGATCAGGTTGCAGATCTTAGTTCAGACCTGAATGTTCCAATTGCAATACG GAAAGGAATTCGACCATGTACACAACACCCTCTTCGCAATCATATGTCTTATGCGAAGTTGTCCCAAACCTACAGAGCGT TTGTGTCCAAGCTAGACCAGGTCCGGATACCCACTTCCATCCATGAAGCTTTACAAATACCCGAATGGAAGGCAGCCACC CTGGATGAAATAAGAGCACTTGAGAAGAATGGGACATGGACGATTACTACTCTGCCTCCGGGTAAGCATGCTGTTGGGTG TAAATGGATATTCTCAGTAAAACACAAGGCAGGCAGTGTGGAAAGGTAGACTCGCCTCGTGGCTAAGGGGTTCACTCAGT CATATGGAATAGACTACCAAGAAACATTCGCTCTAGTAGCCAAACTTAACACCATCCGAGTCCTAATCTCCATTGCAGTA AACCAAGATTGGCCTCTACTTCAACTTGATGTAAAAATGCCTTCCTAAATGGAGACCTCGAGGAATTAGTTTACATGGTG ATACCTCCAGGTTTCGAAGATAATTCCACTACCAACAGAGTCTGCAAACTCAGAAAGTCCCTGTATGGCCTCAAACAGTC TCCTCGGGTATTGTTTGACAGATTCACTAGAGTCCTCAAGAAGGATGGCTATGTTCAGTGCCAAGCCGACCATACATTAT TCGTCAAACATGCTACCGATGGAAGACTCACTGCACTTATTGTGTATGTCGATGACATAGTCCTCACAGGTAATCATTGG GAAGAAATGGAGTGCCTAAAGAAGCTGCTCTCAAGAGAATTCGAAATCAAAGACCTTGGACACCTGAAGTATTTCCTTGG AATGGAAATGGCTAGATCAAGCAGAGGTATCTCAATGTCACAACGAAAATATGTTTTAGACCTACTAAAGGAGACAGGAA TGGTAGGATGTAAACCAGTTGACACTCCTATGGATCCAAATGTAAAATTAAGAGTGCGGACAGGTGGTACAGCAGTGGAC AAAGGCAGATATCAACATCTGGTGGGAAAACTAATCTACCTGGCTCATACTCGCCCAGATATAGGCTTCTCAGTAAGTGT GGTTTGTCAATTCATGAATAACCCTTAAGAAGAACACATGGAGGCGGTGTATCGAATCCTAAGATATCTCAAGAGAGACC CAGGCAAAGGATTGTTATTCGAAAAAACCACAAACAGAACCATTAAAGTTTTCACAGATGCCGATTGGGCAGGATCATCC ACGGATCGAAGATCCACTTCAGGTTACTGTTCATTCGTTTGGGGAAACTTAGTGACTTGGCGAAGCAAGAAGCAGCCAGT CGTTGCCCGCAGCAGTGCAGAGGCCGAGTTTAGAGCATTGGCGCATGGGATATGTTAAGGAATGTGGCTAAAAAGGCTGT TGCAGGAACTTAAAGTTAAGGCAGAAGGTCCTATTGATATGAGGTGTGATAGTCAATCAGCTATAGCCATAGCAAAGAAC CCAGTCCATCATGATCGGACCAAGCATGTTGAGATAGATCGTCACCTTATCAGTGAGAAGATTGAAGGAAAAATAATCTC ACTCAACTACGTTCCAAGGGAAAAAAATCTCACTCAACTACGTTCCTACACGACATCAAACCACAAACATCCTAACAAAG GCACTCCACCGCACTAACTTCCAAGAACTATGTACCAAGCTAGGCATGTTGAGTTTATACAGTCCAGCTTGAGGGGGAGT GTAGAAAATCTCCTAGAAGTTAGTTGTATTTTTATTATTAAAGTAGCCGTGTATATAGAAGTAAAGTAGGGCTGATTATT AGGCAGATTCTTTTCCTAGTTTTCAGGGATCTTAACAACCTAAGATCTCTTTTTCATGTATATAAATATTCGGTCAGTAA ATGAGAAAATTACTTCTTCCCTTCCAAAATATTCTACATAATGGAGAAAAGAAAACACTTATTTTGGACTCCTTGTACTG CTCATTGCATTGATTTGATCCTCAACAAACTAGGAGAATTGCCACAACATAAAAGTACTTTGGTGAAAGCGAAAAAAATT AGCAATTATGTGTATAATCACCCTTGGGTGTTGTCATTGATGAGAAAGTACACCAAAAGGGATCTTGTTCGACCTGCTGC AACAAAAGTTGCCACAGCCTATCTGACTTTGGAGTGCATCATAGGCTAATGCAACCTCTACAATCTATGTTTGTATCGGA AGAATGGAACAATAGTTCATATGCAAGGAAACCGGATCGGAAAGAAGTGAAAAAGATAGTCATGAAGGATAATCAGTTTT GGGCTGCTTGTTGAAATAGAGGATATTCACTTTAATAGTACCGGATTCTAGGAGATATGAATAGGAATGTAATTAGGGAT AGTCAACGACTAAGGATCCGGAAAGGATATTAGTGTACAGCTATAAGTTTCCTAGTTTAGCTCCTTGTATGAATAACAGA AAACAATTCTTCCTTCCATTACCTGTGTTCTTCTATTTGGTATCAGAGCAATTACCGATACCCTTAGAAAACCTAGCTGC CATGTCTGAGGTTGCATCCGAATCCACCACCTCCTTTGTTGTTCAGACAAAAAATCCTGAGTCTCAAGTCCAAAATTCTG AAACTCACTCTATCCAAATCACCACTATTCGGCTGAATGGTGAAAACTTCCTCCACTGGTCTCAATCCATGCGGATGTAT ATCAGAGGCAGGGGCAAAATTGGTTACCTGACTGGGGAGAAGAAAGAACCAGAGACCAAGGATTCGTCTTACTCGACCTG GGATGCAGAAAACTCGATGGTAATGACTTGGCTGGTGAACTCCATGGAGGACATCAGTTCCAATTATGTGTTACCACACG GCAAAAGAACTCTGGGACAACGTTAACCAGATGTACTCAGACCTGGGAAATCAATCCCAAGTCTTTGAGTTGACGCTGAA ACTCGGAGAGATTCGTCAAGGGGATGATAGCATTACAAAGCACTTCAACTCCTTGAAGCGCCTGTGGCAAGATCTTGACC TATTCAGCGATTATGAATGGAAATCGCCTGAAGATTGTAACTATTACAAGAAGACTGTCGAAGACAATCGTATCTTCAAG TTTCTCATAGGGCTCAATGTAGAATTCGATGAAGTTCGAGGGAGAATCATTGGAAGGCAGCCTCTGTCCTCAAT