>DTA_23_1_Mno length=2544;Class=DNA transposons;Order=TIR;superfamily=hAT; CCCGTGCCTGCGTGGGAAAGAGAGAGTGCCAGAGTGGGGTTGCGTGCGTGGGAAAGAGAGACTGATATGGCACTTCATGA AGTGATAGGACGGACGTGCAAATTGTAATAAACATTAAGGCCGCGCTTCCATCTTAGTTTTTGCCTATATATAGCCGTGG AAACGTTGCGAATGTGCAGACGTGCTTCCATCTTAATTTTAGCTTTTTATTAGTTTACAATTCTTCACTTCTTCTTAAAG GAGAAAAAAAAACTTAAAAGGTATAATTTATTTTATTTGTTGTTCATTAATTTTATATTGTTATAAGTTAATTTTATTGT GTAATTATCTCATTTAATTTTTATTGATAATGTTATGTTAATTTATTGTTTTTTTTTAAGTAATGACATCATCACATGGA AAGAACACCAATGTTTCAAATTTGGTGATCAATGAAGAAGAACAATTTAATGATCCACTTGAAGAAATTGGAGCTGACTT AGTATCTCAAGTTGGTGGCTCCTCTGATGTGACTCGTAAAGGTAAAAGAAAAATACAACGAACTTCACCAGTTTGGAATT ATTTTGATTTAGTAATGCGTAAAAATGAGAATGGTGTAATAGAAGAACGTGTAATTTGCAAAGTATGCAAACAAGACTAC ACAGGTAAATCCTCTTCTGGTACTGGTCACTTAGAGAGGCATCGCAAAAAGTGCGAAGCTAAGCATGGTGTAGGTGGTGT TGATTGTTGTCAACAAACACTTCAATTTAGCTCTGATGGTAGTGTTACCAATTGGTCATATGACCAACAAAGAGCTAGAG AATGGCACGCTAGATATTTGGCTAGTGTTCAACAACCAATTAGTCTTGCAGATGATCCGGCCTTTGAGGAGTACATTCAA AATGCTTATAATCCACAATATAGGCGTGTTTCAAGAACTACCACAAGAGCTGACACTATGAAAGTATTTCATTCAATGAG AGAAAATTTAGTTAATGAATTTAATTCATTCACTGCATCTGTTGCATGCACATCTGATTTGTGGGAAGGTCGCACCAAAA CTAGTTATATCTGTGTAACGATACATTATGTGGATAAAGATTGGTCTTTTCAAAAAAGGTTAATTACTTTTCGATCAATG CCTTATCCACATGATGCCAAGGCCATTCATGATGTCATCATGAAAGTTTTGATTTTTATGGCATTAAAGAAAAGGTTTTG AGCATCACATTTGACAATGCATCTGCCAATACTGCTGCGATAAACCTTTTCAAGACAACTTTGAAACCACAACATGGTGG AACACTTTTTCACCAAAGATGTGCTTGTCATATTATTAACTTGTGCGTTCAAGATGACATGAAATTTTTTCAAGGTTAGT TAGAAAATATTCGAACGGCCTTGGGTTACATAGCAAGTTCTGGCTCTCGAATTGAAGAATTTGCTAAACTTTGCAAGAGA GCAAGCATGAGCCCAGAAAACTTCCTACTGACGTGGGACACCGATGGAATTCAACATATTTGATGTTGAACGCATGCCTA CCATACAAAGAGGTCATAACCGCGTATTACAACTTGAAGAATCCAACTGAGCCGTTTCAAGAAATTGATTGGCAAATTGC TTCATGCTTCTATAATTTCTTGAAGGTTTTTTATGAAGCCACTCTCCAACTCTCAAGTGTGTACAATCCCACCTCTCCTC ATGCATTACATAAATTGTACGACATTGCTGCTGTTGGGAATAGTGTCCTAGAAGCATAAGATGTAATAGAATATTTGTTA TTTAATTAATAAAAGAGTTTATTCATCATTTTATGTGCATATATTTATGAATATTTTATGAATATAAAATGAAAATTTCG TGATTATTTATGTAACCTTAAACATAGTATATAAGTGTTATATATAAGAGGATAGTGTTTAAGGATAATAATCAAAAACA TTGTTCATAATGAATTTAATTAAAGTTCGGAATCTTTAATTAAAACATTATTAATACATGNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN