>DTA_22_1_Mno length=6567;Class=DNA transposons;Order=TIR;superfamily=hAT; CAAAGGTAAAAACTTCGAATTTGTTCCATTTGGGACTGGGAGAAGAAATTGCCCAGGCATTTCATTTGCTTGCGCAAATA TTGAACTAGCACTTGCACAATTATTGTACCACTTTGACTGGAAACTTCCTGATGGTGCTACACCAGAAGAACTTGACATG ACTGAGATATTCGGCACATCCAGCAGGAGGAACAAAAATCTGTGCTTAATTGCCACCCCCTATGTAACCTTAAAGTAGAT GAGAGTGAGACATGTCAAAATTAGCTACAATGCAACACATGACAACTGAATCACATCAAGTTCGAAACTGTTGCGCATCT TCTTTTTCAATTGTATTTAGCAATGAAACTGAGTTGAATTTCCTATCGTGCAGTAAAAATATCAGCTAGACGATTTTTGC AAAATATCAAACACAGACCTCAGCAGGATTGATGCCTTTCGGAACCAGCATCTGAATTATCATAAACAATTTTAGCTGAG ATATTGCGCATCGAATTTATTAAGTAAAACGATCATGTCTGTTGTAAACACATCTATCTTTTCTACCAAAAAAAAGACGC CTCATCTATCAACAACAGTGGAATGACGCCATAGGAAAATGGGAATTCATTGAACTGCTTTTTAAATCAAACGAAACTAT TTTTACAGACGACCCTACTAATTGAATATGAAGCTTGACAAGGTTTTGCAGAAATCCCAACTAAAAGATAAGATAACGAA GTTTAACTTTATATGCAAATATCTTATCTGATATTAGCAAATACAAATAAAAAAGTTATACCCTATGACGAAATGTACGT GCCACATTCTCTGTAAAACTAGGCCTCGCTTGATACGTGAAAAAGAAATGGAGTTTTTGAATGTTATAAGTCAGCTCCAA ATGCTTTGCTCTCATTCGTTAGTCCAGAGCAGATAATCTTATTTCTGTCAAAACCTTCAGGTACAAGGCGCCTTGCTTCC ATCTCAGAGCATAACAACATTACCAATTTCTCTTTCCCGACCCGGCATAGTCCTGCACAAAGCTTATAGAAGACATCCAA ATCAGGAACCACGAATCTGTCAAACATTTCTCTCAGGACTTCAGCTCCTCCATCGAAATCCTCATTCTTGCAGAAAATAC TTATCAACATCTGAAAAACATGTCCATTAGGAGTGCAGCCGCTCCTTACCATGCTTTTATACAGTTGAAAGGCACTGTCG GAGTTTTTCCTCAGACATTGCCCACTAATAAGGGCAGAAAAGGTAGATGAATTTGGAATTAACTTCTTCTTATCAAGCTC TTTAACCAGATGTGCAGCTTTCTTGGTCTTGCCCTCCTTGCATAGACCCAAAATTAAGGAATTATAAGTCAGGATATCAG CCTTCACTCGGTTCCTTAACATCTCCTCATAAAGCCTACCGCCCATCTCCGAATTACCCTCTTGGCTGTACCCATTTATC AAAGTATTGTAGGTTACAGTATTCGGATCCAACTTTATCGCCTTCATTTCGCTGAAAAGTTTATTTGCTTCGTGCAATTT CCCATCTTTGCAGAACCCGTCAATAAGGGTGTTAAAAGTAATCACATTTGGCTGCACCCCATTCTTCCCCATCAGAATTT TAAGGTTCATAGCCATGCTCAAAATACCCTTATCGCAGTACCCCGATATCAACGTATTATAAGACACAACAGTCGGGCTG ACACCCATGTTCTCCATCTCACCAAAAACCTCAGCAGCCTTATCTACTTTCCCCAATTTACAATACCCACAAATCACCAT ATTAAGAGTAAAAACATTCGGCGAAATCCGATACCGACGCATTTCTCTATAGAACGCAAAAGCAACATCAACTCTATGGA GATGAAGCAAAGAGCTAATGTAGGCATTGCAGGACTCAACCGTCGGCAGAAACCCGTAATCTTTCATCCTGCAGAAAGTG TCCGTGGCATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCCTGAATTTTC TCATGTGGGCAAAAGTCTTGAAAAGGGAGTCAAAAACAAGAGAAGTAGAATTACACAACCGGTACGAATATAACATTGCT TCAAACAAATTAGAGGGCAATTGTATCGAATCCGAGACAAGAATGGTCCTCAAAATAGATTCTGCAGATTTGAATTTCCT GTTTCTTGTGAGAATATGGAGAATAATTGAATTTGTTTCAAGGGTATGTACAGTGGGATTTTGACTATTTACCCAGTTGA AAAATTCGAGTGAAAGAACATGGTCCTTCTGAATTCTTAACAATACATGTTTTACTCTAAACGCTGTCAACCCACTTGAT AAAGGGTCAAGCTTATTCCAGTCAGAGTGGATCAGATGGCTATGAACAACATTAACGAAATCAAAATCTTGTCCTTTGGG TTCTGGAATTGTTCTGTGGGGTATTGGAATCGGATTCCAATTCCTTCTTCCCAAAATCCCACGAGACATAATAGAGTTAG TAATCTGATTACTCATGAATTAGTAATCAGATTACTGATTTCATATCCAGAGCAAACTGGGTCTTGCTAAACAAACAGAA ACAAGGAAGAAACATGAACATGAAGAAGGTGTGAAGACCCACTAACCTGACGATCCTTGCAAAGGAAACTCAGTGGGTAA TTTCAACAAACACTTTGCGATCAAAATTTATTCGCTACTATTATGGCAAATTCATGTTGTTTCTTTTTTTTTTTTTAAAA GCAATTTTCTGAAACTACGGGACTTTCATGGAAAATTTTCCCGACAACTCAAGAAAGGAAAATAGGGAAAGCAAGTTTCG GGGTGAGCTTACACGATCACTGGCTTTCCAAACGACCCCAGAGCATATTTGAACTTAGTAGCGGTAATCATATGCCTAAT TCATGGTAGAGATGTCAAATGGGCCAGGCCGTCATAGACGGCCCGGCCCAGCCCGTAATAGTATCGGGTTTGGCATGACC CGGTCCGCTAGTGTTAAGGGTCGTGCTGGCCCGGCACATGTAATGGGCTAGGGCTGGGCCTTGACTTCTCAACCCGCGGC CCAAGCCCAGTTCGATTCAAGCCCGGATTCGGCCCTGGTTCGGCTCGGCCCAGGCCCGCAAAACGGGCCATTCTAAATGC TATTGTTGGGCCTTCGCGGGCCCAATGGTCGGCTCGTGACGGGCCTCCTGTTTGGCCCGTCACGGGCCTCCCGTTTAGCC CGTGATGGGCTGCCGTTAGGCATGTCACGGGCCGCCCGTTGGGCCCGCGAAGGGCCCAACGTTAAGAATCTGAAAACGCT AAAAAAATCTCCTATAAATACCCCTTAATTCCACCCTAAATCCCACACAACAATTCACTCTCAACTTCTCATCTCACTCT CATTCTATCTCTCATCTTATCTCTTTCCTTTTGATTCTAAGCTTTTTTCTCGCGATCACTCATTTTCTTGCTCTTTCATT TACAAAGTTCACGTTCAATTAATTTTCAGAAAATGGCCGCATCAAACTTCCCTGATTTCACTGCTCTTCCTGAGCTTGGT AATGAGGCATTCTTTGAGGATGAAATGATGCCTCCCAACCCAACCCCTACTGAACCAGAAAATGCTCTGGTATATAATGC TTTAGTGCACAATGAGGAAGCTGGAGAACGCAGCAGGGGAAAAAGACCGCGAACTTCTCTGGCACGACAGCATTTCACTG AAGAGCCCTGACCAAATTCAAAAACAGGTGAAATGGAAATTTGTGTGGTATGTAAATATTGTAGAAAACACTTTTCTAAT AAAAAGGGTGGGGGTACTGGTCATCTGGATAGACATTGAAAAGTATGTCTACCGTTACACCAAGGTGGGAGTGTGGACTC CCGCCAACAAACACTATCACTCACATCACAGGGGTTACAAAATTTTACATATGATGCACAACGTGCTCGTGAGACACTAG CTAAATTTCTAGCTAGTGTCGAATTGCCTCTTTCTTTGCGCCGTCGAAGAGTTCATCCAAACAGCCTTCTGCCCACAATT TAAACGGGTAAGTAGAAACACAACTCGTTCTGATTGCATGAAAGTATTTTATGCAATGAGACAATATCTTGTTGATAATT TTAAGACTTTTAAAGCTACAGTCTCTTGCACTTCTGATCTATAGGAAAGGTGCAATAAAACTGGATATTTATGTGTTACG GAGCATTATGTTGATGACGAATGGGTTTTACAAAAAAGAATATTTGATTTTCGTTTATGTCCATATCCTCATAACGCATC ATCTATTTTTAGTACAATAATGGAAATTTTTGGGTTTTATGGGATAGAAAATAAAGTTTTAACTATTACTTTTGATAATG CGTCAGCTAACACGGCTGCAATTAACATGTTTAAACGTAGTTTGAAACCAGCGTTTGGGGGGGGGGNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNGGGGGGGGGGGGGAGGGGAATTTTTCATCAACGGTGTGTATGTCACATAATTAATTTAGTAGT GCAGGTAGGAATTGAACATATTGCATCTAATCTAACAAATATTAGAGAATCATTATCATTAATATCTAGTTATGGAGCTC GGCTCCAAGAATTCAAACAATATTGCAGGAACAGCCAGCTGCGTCCAAGAAAGTTTCCAACTAACGTGAGACATAGGTGG AATTCTACCTATTTAATGTTGAAGGAAGCACTCCCATATTCGCAGCTTATCACGACGTACGTAAATAGTAAGAACGATAA ACTTTTAATTTTCGATACAGATTGGTGAGTATTTTTTAAATTTATGGAAGTTTTTAACAATGCTACTGAATTACTTTCTG GAGTTTATTATCCTACATCACATTTAGCTTTACATTAACTATTTAATATTTCAGAAACATTTTCTTATTATAGGGATACA AAACTTTTTGGAGACATAGTTAAGTTAATAGAAAATAAATTTAAAAGTTATTGGTCAGGTTGTTCTATGGTATATGCATT GGCAACTATTTTAGATCCTAGGTACGGAGTAGATGTGACTAACTCATTGATGACTGCTACCGCAGAAAATTTAGGAATAG ATATGCAACTAACTATTACTGACGCTAAGAGAATGTTAGAAAAGATTTTTAGTTTGTATGAAGCAAAATACGACATAGGT AAAAAAGAACAGAGAACTTTGACGTCAACTAGCAGTTCAGGGCCTAAAGGATCGTCGTGGAGTTTCTTAAAGAAGAAAGA GAGAACGGCAGGATCGTCATTAACACAAGCCTCTACCGAACTAGTAAAATATTTTGAAGCAAATTTTGTAATCGATGACG ATAAACTAGACATCTTACAGTGGTGGAAGAGAAAGCCCGATCGTTTTCCAACCCTGTCCGTAATAGCTCGTGACATTCTG ACAACTCCAGTGTCAATGGTGTTGGCCTAAGGTTGAATATTCTCATGTTTTGATGATAACAAACACAATGTATTATGTTA CTAATGATTCTATTTTGAGTTGTATTTTTAGCATAATTGATATTATAAATCAACTCAAGAACCATATTGTGGAATACAAT GCATACATTTAAGGTTGAGAAATGCAAATTGAAGAAGGAATTCAAAGCTTGAAGTGTGAAATATCAAAGACTAAGAGCAA GCAAACAAAATCAAGCAAGACAAGTACTACTAGGTTTTTGTATCTCCTTAGTCTTGTATTTGATTTTGACTTCATACTAT CATGATTAATTCGTGGTTAGGCTTATGCACACACTCACATTATTCTTTTAAAATGAGACTAAACTAAGTGCATAATGACA TTTGGCCTAAAAGTACAATCTTGTGAAGGTTTGAGGCAATCTAAGTGTCAACCGGTTGACCTATGTCGTCCGGTGACAGA GAAGGCTAAATGCACCGATCGACCAGTGCTGCCTCAACTGGTCAACCACTCTGGTCGACCAGTTCTGTTCAACAGATACT CAATAAGACCGTTGAACAGCGAGAATTCAAATTTGTCTCAACCGGTCAACCACTCCGGTCGACCGGTACTGGGTAAACGA TCAAAAATAAGACCGTTGGAAAGTGAGGTTAAATAGAGAAAAGTCATTTTTCTCTTCTGCGGATTTTCCTAAAAATAGAG AAATTGTTCAAAGCTCCTAAATTTCTTAAAAATTCAAAAAGGTTTCTCTAAAGTGCCATCATAATCATCATCTTCTCAAA ATCCTTACTTCACTCGCTCACACATACTTGAGCCTATCTTGGATTATATTTTGATAGTGTGATTTCATCATCTCCTAGTC ATTTCAATTGTGTAAAACCATTGTTAGGAGTGTATGACTGAGTGATTCACTGTTCATAATCATTACTTTCGTATTTGGTT TGTTGGTTGGTCGATCTCCGTTTGTGTAAGAGGTTAGGCCAAGCCTCGGATAGAAAGATCCGCCATCTTGTAAGAGGAGT GATCGTGCCGGATAGTCGATCGTATAATGGAAAAGGTCGAGAGGCGGAATATCTCGGCAACAGTGGATGTAGGCAAATTT ATTTGTCGAACCACTATAAATCTCGTTTGCATCTCTCTCAACCCTATCTCTCTAATTTCCACACTTTAAATTTGATAGTT GACATTG