>DTA_21_1_Mno length=2591;Class=DNA transposons;Order=TIR;superfamily=hAT; TACCGTTGGGTGGGCTGACTCACTGCCGTGAGGCAGTGAGTAATAGCCTTGGGCCTTGGCAAAGGGCTGCAGTCTGCAGC CCTCTGCCAAATTTTTTTTTTCCTTATGCTTTTTTTTTTCTCCCTTTAAAATTTTTAAATCTTGTCTATAAATACTCCCT CTATTAATCCATTTTTTTCACTCTCTCTATTCTCTTCTCATTCTCTAATTTTTTTCTCAACTCTCAATTCTCACTCATTA ATTCTCTCAATTTTGTTATTTCATTTTTGTTTGAAAAAAAAAGTTTGTGATTCTCTAATCTCTACTCTAGTCTCTACTTC AATAGAAAATGGAACCAAATATGTATAGGTATGGTCTTGATGGTGTTGACTACTATGGAGTGGATGATCAAGACATTGAG GAAGCAACAATTCAACGAATGGAGGCGGGTGACCAAGTAGGTGACATGCCACTAAATATCAATATTCAACCGAATCAACC CTTAGAAATGCCGACGGGCTCAAGTGGTTCAACATCATCAACGACAACAAAACATTCGAGACAACGTGCAGAATATTGGA AATACTTCACTACACAAGAGAAAATTGACGCTGGAGGTAAGAAAATAAAATTAGCTACATGTATATATTGTAAAAAAGTT TTGACAGCAAATTCTATGAGTGGAACTCGACACTTAAGAGATCACAGAGTTAAATGCGCTAGACTACATCAAGCCAGGAC GGAGCTTACACAAACTCAACTTCAATTAAACCCGGATGGTTCGGTAAGTACTTGGTCCTATAATCCTCAAGTTGCTAGGG AATCTTTATGTCGATTTATTTCTGCTTTAGATTTACCTATTAACCTTAGTGATAACCCACATTATGAAGCGCATATTCAA CGTGCATATTGTCCTCAATTTCAAAAAATTTCTAGAACTACTACTAGGAGTAATATGATTACATACTATGAGAAAATGCG TCTTGCATTAATAGCTGAAATAGGTGTATTAAAATTTTCAATTGCATTAACCTCTGATATTTTGAGTGGTAGGGCGAATC AAGATTATTTGAGCGTAGTTGCACATTATTTAGACTCTAAATGGAATATGCAAAAAAGAATTATTGATTTTAGACTTATT GATTGTTCACATAATGCTGACAATATTGTTGACAGACTTGTTAGTGTTATTCAAGATTTTGGTATACGAGACCGTATTAT CTCTATCACCTTAGATAATGCTACAGCTAATGCAAGGGCGATATCAATGTTGGAGGGACTTATAAACTCNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNCCTCATTGTCAAATCATGTATGCATATGGTAAGTTCTACAATTGATAATATTCGAAATGCCATTTCTTG AATTCATAATTCAAACCCCCGTATTGCTGAGTTTAAGAGGTATTGTAAAGCAGAAGGTATGAAGCCTAGAAAGTTTAGTC TTCACATGCCTGTTAGGTGGAATTCAACATATATGATGTTGAAGAATACTTTGCCATATAAAAATATTATCACTATTTTT TTCAATACAAAAATGGGCAAAACAATGTTGCAGGAAAATGATTGGTTTATTTGCGAACGATTTGTGTATTTTTTGGAAGT TTTTTATGATTCTACTGTTTTATTATCTGGTATTTATTATCCTACTTCTCCATTAATGTTGCATCAAATTTGTGAGATTA CAGACTTATTTGAAATGTATAGAAATGATATGTTATTTAAACCGATAGTAGAAAAAATGGAAGTAAAGTTTAGGAAATAT TGGTCTGAAATTCCTCTGTTGTATTGTTTAGCAATTATTTTGGATCCTAGAGTAAAATTATCCGGTCTTGGAAATGTTCT TTCTCATATCGGTGGCCAGTTGGACATAGATTATACTTCACAGGTTGTTAACACACGTGAGAAGTTATTTGCAATTTATG TAATTTATGAGAACAAGTTCGGTAACTTGAGAACTCAACAAACGCAACAAGATCAGCCGGCCCGCTCAAAAAAGAAGTTT TGGAATTTTATATCTTCTCATCGTGGTGGCTCTAGTTCATCATCAACTGCGACTCCGAGTGTCATGCCACCACTATCAAC ACCAACGACGACACAATATAGGGAGCTCAACAGATACCTTGAGACAGAATTCTCGGTGATAGATGGTGCTGATAATTATG ACAATTTCAAAATTTTGGCATGGTGGAGGCTACAAGGTGTAAGATTTTCAATACTTTCAATATTAGCACGTGATATCTTG ACTATTCCAGTATCAACGGTGTCTTCAGAATCTGCCTTTAGCACAGCTGGGAGGATAATTGAAGAACGAAGGACTTCGTT GACTTCAGAAATGGTTGAGGTGCTAATATGTCTAAAAGATTGGGAAAATGCTTCTTTGCGAATGCAACACACAGCCGAAG ACAAGGATTTAATGGATCAATTTTAAAACTTATACATTGACGATGACACTTCTGATGCGGGGAGTAGTGTAGCAGGCAGT TAGATATTTTTGTTTCTTAATATAAATTGTA