>DTA_20_1_Mno length=2594;Class=DNA transposons;Order=TIR;superfamily=hAT; TTGTTGATTTGAATTTTTAATTTGAGTTGAGATGTGACTTTATGTGAGTTTTTTACTGTAAAAAAATTAGATTTGACTGT TTTTAAAATTTTTTTATTGTAACAAAACTCGAATCGGTGAGCCTAAATTTTTAAATGATTATAATACAACTTATTGGAAT TTTTTAATAATATCATTGTCAAATTCTTTTTTTTTTCTTTATAACAGCAATGTGGCAGTTTTTGAAAAGAAAATCAGATG AGACAACACTTCCTAGTCCTAGTGAAAAAATAAAGTTGCAAAAACTTGGGTGGAGTTCAACCCTGAAAGTCTCCCAACAG ATCCTGGATTGAGGCCTTCAATTTTCGATTACAATCATAATGTTCGGAATCAAGTTCGAAGAAAATATATGAATAATGGT CCTTTCAGTCTTCAAAGCATAATTTTCCATTTAAACAATTTGGAAAAGAAACAAGAAGATTCAATCCTGATTGGTTTAAG GAATGCTCAAATTGGTTAGAATACAATATATCAAAAGATGCTGCATTTTGTTTGCGTTGTTATCTTTTTAAACCGTATAA AGGAGAACTAGCAGGTGGCGATTCCTTCGTTGGCAAAGGATTTTCAAATTGGAAGAAAAAAGATAGATTGTAAGTTCATG TTGGAGGTCCTAATAGTGCTCATAATGAAGCTTGGAGAAAATGTGAAGCTTTGATGAATTAAGAGCAACATGTTGATAAA ATTATGGAAAAGCAAACTCATCTAAATGCATCAATAGATTGTGTTCGATTTCTTTTAAGACAAGGTCTTGCATTCATGGT CATGATGAATCAGAGGAATCGATCGATCAAGGTAATTTTCTTGAGCTTCTGCAATTTCTTTCTGCTCACAATGATGAAAT TAAAGGTGTTGTTGGACAAAATGCTCCTGAAAATCTCAAATTAACATCTCCTGACATCCAAAAGATATTGTGAATGCTGC TGCTGTTGAAACTATCAATGTCATTATTGATGATATTGGAGACTCATTGTTCTCAATTCTTGTTGATGAATCTCGTGACA TATCAATGAAAGAGCAAAGAGCAAATGGCAGTTGTGTTGCGTTATGTGAAAAAAATGGGGCATGTAGTTGAACGTTCTAT TGGTATTGAGCATGTTACTAGTACTACAGCACGTTCGCTAAAGGCTGCGATCGCATATCTAGATTGTAGGGGCAAGGTTA CGATGAGGCTAATAATATGCAAGGTGAGCTCAATGGTCTTAAAACTCTTATTTTGAAAGAAAACTCATGTGCCTTTTATA TCCATTGTTTTGCCCATCAACTTCAGTTAGCTCTCATATCTGTTGTCAAGAAGCATATTCAAACTGCATCACTCTTTTGT GTGGTTGCTAGTGTGGTGAATACTGTTGGCGCTTCACCTAAACGTTGCGCCATTCTTCAAGATAAGCGAGCTGTCATAAT TGCCCAAGCAGTTAGAAATGGAGAGATTGCAAGTGGACGGGGACTAAATCAACAAACTTCTCTAAAACGTCATGGAGACA CAAGTTGGGGCTCACACTATGGTACGTTAATTAGCTTGGTTACCATGTTTTCATCTATAGTTGAAGTCCTTGAAATAATT GTTGATGATGGATTGAGTTCTGAACAAAGATGTGAAGCAAGCAATTTATTGGATTCGATCCAATCATTTGATTTTGTGTT TAGTCTTTCATTTAATGAGAAATATATTGGGAGTTACAAATGAGCTATCAAAGGCATTGCAAAGAAAATGCCATGAGTTT AGTGCAAATATGCAAACAAAGGTTGCAAACGATGAGAGATAGTTGGTGAGATTCACTTTTTGATCAAGTCTCTTCATTTT GCCAAAATCACAACATTAATATTCCCAACATGGATGACATCTTTAGAGCGCGGGGATGATCATGACGCAAAGCTTAAGAA GTTACAAACTTCACCAATTTCGCGTGGAGTTATTTTACTCTGTCATTATATGCAACTTTAAGAATTAAATAAATATTTAC TGAGGTAAATACTGGGGTGCTTCTCTGTGTAGCTTACTTATGTCCAGATGATTCATTTATTGCTTTTGATAAGAGAAATT TGATCGAACTTGCTAAGTATTATCCGAAAGATTTTTCTGTGGTCGAGCTTATGGTCTTGGAGAATCAACTTGAAACTTAT ATTATTGATATGCGCTCGAGTGAAGATTTTACAAGATTGAAAGGTATTAGTGCTCTTGCACAGAAAATGGTTGAGACGAG AAAGAAAATGTGTATCTATTAGTTTATCTGTTGATTACTTTGGCATTGGTTTTATCGGTTGCTATTGCTACTGTGGAGAG AGTATTTTCAGCCATGAATATTGTGAAGAATCGGTTACGGAATCGAATCAGAGAATAATGGATGAATGACATTTTGATCG TATACATCGAGAAAGAAATTTTTTATCGTGTTGACAATGAAGATGTTATGCAGCATTTTCAAAAAATGAAAACTTGTCGT TTATATTGTTATATGTCTTGTGAATTTTTTTATATATGTATTTTGTAGCTATTGAAAAATATTATGATAGTTTTTCATAT TTTTCATGTAATTAATTTGTTAAAAAAAATTAGT