>DTA_2N_1_Mno length=814;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGAGATGCAACAATGGGCCGGGGCCCGTGGGCCGGCCCAGGCCCATCCTGACACAGTGACGGGCCGGGCCGGCACGGCC CGTCACTGTTCAAGGCACGGCCCAGCCCATAAATATTGGTGGGCTGGGCTGGGCCAACATATATCGGCCCATGGGCCGGC CCGGCACGGCCCATGAAAAATCATGGGCCAGGCGGCCGGCCCGTCTAGGCCCATGATGGGCCGGCCCAGCCCGGCCCGTC TAGGCCCATAATGGGCCGGCCCAGCCCAGCCCATCTAGGCCCATAATATTTTTATGTTTTTTTTTTTTTTTTAGTAATTT TGTAAACATCTTATGTATAATTATCCTGATTGTACTCTTTTTTTCTTACCAAGGTTTTGTCCCACTGGGTTTTCCTTAGA AAGATTTTTATTTAATGAGGTAATCGTAAATAAAATATCATTTTTCATATTTCCATTGACTATTCAAACTTATATATTTG TTAACTTGTTTAAAAATTCAAAAATAAAAATTAAAAAAAAAATTAAAAATTACATGCTTAGATGGGCTGGCCCATCTAAA CCCATGATGGGCCAAGATGGGCCTTGAGTGGGCCAGCCCATTCAAGGCCCATGGCACGGCCCATCCTGGCCCGCGGCACG GCCCAGCCTGGCCCACGTAAAATTGGCCCGTGGTGTGGGCTGGGCCGAGGTCATTCTTATACGGGCCGGCCCGGCCCGGC CCACAAAATTCGTGGGCTGGGCCGGCCCGGCCCGCGGCCCGCGTGGGCCTAAGGAGAACGGGCCGGGCCGGGCCGGCCCG TTCTTGCATCTCTA >DTA_2N_2_Mno length=1544;Class=DNA transposons;Order=MITE;superfamily=MITE; GTAAGCAGTGTTGGAAGTTCGGGTCGGCGGGCTGCCCGAAGCCCGAATTTTTTCGGGCTCGGGCGGGCAAGCCCATCTCC CGCCCGCCCAAGCTAGATTTTCGGGTTCGGGCTCGGGCAGCCCGAATTTGACACTAACTCTCTTGCCCGCCGCCGTCTAA CCGCCCTATACCGCCGTCCGCCGGAATTTTTTTGAATTTTCCGACCATGCCCGACCCGCCCGAATTGCCCGACCCGAAAA TAAGCCCGAAAACCCGAATTTTGCCCGAAGCCCGAGTTGCCCGATTTGCCCAAAACCGCCCGAAAATATTAGTTGCTACA AATTGGGGCATTCCGAGAATCGAACTCGGGACCTCTCACACCCAAAGCAAGAATCATACCACTAGACCCAATGCCCATAT TTGTTATTTAAATTTTTAACTTTTTAATTAAGGTAAACACACAATTCCTTAATAGAAAGAGCAAATTCCTATTTTAGCAG TTTAATATTTCAGTTTTCACATTCTTGACCCTTTTTTATAATCAATCACATGATAAAATGATTCCTCAAAAAACAATATA CACAAGGAAAGAAACACATTGCCATCACGTTTTTATTATTTTTTATTTTTAAAAAGTGTTGTTTCTATATAATGCCGGTT TTGTTCTTATAGATACTCGTGTTTTTCTATTCTATATCACTCTTCTTTCTATCTTTATCTATTTTTCTGTTCACAATCTC TCCTCATCCTCTTAATTATCCTCTTTTTTCTTCAACTTTCTTCACTCTCTTTGTGACTCTATATCAAAGTAACTTTCTAC TTGCATACCAAAGTAAATTGATAATTTATCAAAAGTCACTCAATGATTGGTTTGGTTTAATAACTTCATCGCTATTTGAT GATCTCTATTTTAAAAGACCAGTCACTCAATGTTGAAGCCTTGGTTTGCATTAAGGATTGGGATCGGGCCGATCAACATT TACAAGATACAATTTCACCGGCAAGCCAATAATGGATCGATGAATTTAATCGATTAACATTTAATTTTGAAGACGATCCT TTAGCTTTAAATTAAATTGTAAATTTGTAATTTGTAAATATGTATTTACCTTTGACATTGTATTTGTAATTGTATAACTT TGTAAGTTTGTAAAATTTGTAATTCGTCACAATATGATTGCACTCTTTTTTCCTTGCCAAGTTTTTATCCCAATTGGGTT TTTCTTGGTAAAGTTTTTAATGAGGTAATCATGAATTATAAATTTAAAAATTAATAAAGAAAGAATTTTTTTATATAGTT CGTGTGTTCATTTCAAATTTCAAATTGTAATATATATATATATAAATTTTAACACAAAATAACTTAATATTAAAAAAAAA GTTTAAATAATTCGGGCAATTCGGGCGGGCTCGGGCCGCCTAATACAAGCCCGCGGCCCGTTCAAGGTGAAATTCGGGCT CGGGCGGGCGGCCCAAATTTCTCGGGCGGCTCGGGCTCGGGCTCGGGCAAAAACTCAGGCTTTTCGGGCGGTCGCGGGCG GCCCGTCCAAAGTTCCAGCACTAT >DTA_2N_3_Mno length=710;Class=DNA transposons;Order=MITE;superfamily=MITE; AACTAGTGCTGGAACTTTGGACGGGCCGCCCGCGACCGCCCGAAAAGTCCGAGGATTTGCCCGAGCCCGAACCCGACCCG CCCGAGATTTTCGGGCCGCCCGCCCGAGCCCGAATTTCACCTTGAACGGGCCGCGGGCTTGTATTCGGCGGCCCGAGCCT GCCCGAATTGCCCGAATTTTTTAAATTTTTTTTAATATTAAGTTATTTATATATATATTACAATTTGAAATGAACACACG AACTCGGGTTTTCGGGCAGAATTCGGGTAAAAATTCAAAAAATAGCCATTTTTGGGTTTTCGGGCAACTCGGGTTTTCGG GCAAAATTCAAAAAACTAGCCGTTTTCGGGTATTCGGGCAATTCGGGCACCTCGGGCGGGTCGGGCAATTCGGGCAGGCG GGAAAAATTCAGGCAAAATTCAAAAAAAATTCAAAATTCAGGCTTCGGGTCGGGCAATTCGGGCACACCCAATTTTCGGG CAATTTTCGGGTTGGGCAGTTCGGGCTTGGTCGGAAAAATTCAAAAAAATCCCGGCGGACGGCGGTATACGGTGGTTAGA CGGCGGCGGGCAATGGTGGACATGTCAAATTCGGGCTGCCCGAGCCCGAACCCGAATTTCTTGCTTGGGCGGGCAGGAAT TGGGCCGGCCCGCCCAAGCCTGAAAAAATTCGGGCTTCGGGCGGCCCGCCGACCCGAAGTTCCAGCACTA