>DTA_19_1_Mno length=2614;Class=DNA transposons;Order=TIR;superfamily=hAT; CCAAATGCTAACCCCATAAACGTCAATCTTCATAAGTAACTTTTTTTTTTCTTTTTTTTTTCTTTTTGCATGAATCATAA TTTAGAAAATTAGAATTGTAGACCAACTTCATAAAAAAATTCATATTGCTTGAATCATTATTCAGAGAACTAAAATTGTA GAAGCACTTCATAGTTGATTTATATTTCTTTAATCTTATATTGTCGTTCTTTCTTCTTTTTTGTTTTTTTCCTTTTTTTT TTGTTTTTGCATTCCACTTCTTTAGTTTTTAATGATTTTTATAGCGTTACTTACAATTAGCTAAAAATTGAAACATTTTA GCTTTTTGAACAGTTATGCAGAGAATTGACACATTTTTTAAATGAAAGTTAAGAACCCCCATTTCCTGAAGGAAAAAAAA TGATAAAAGTGCAAAATTGGCTAGTATGGAAAAAGATATTGGTGACCAAAATGATAAAAGTGAAAAATTAACCAGTATGG AAAAAGATATTGGTGACCTTCCTACAGATCACAGTATAAGAATTTTGATTATGGAGTATGATCCCAATATTGGAGACCAA ATTCGAAGAGCATATGCACTAAATGGACCGTGTCAGCCTACAAGCAGTCTTTCCCATTTAGAAAGTTTGGAGCATCATCA AGACGATTCAATCCTGATTGGTTCAAAGAGTACGGTAATTGGTTTGAATTTTGCATAGAAAAACATGCCTCTTTTTGCTT GTATTTTTATCTTTTGAAGCAAAAATTTGGAGAGCAATCAGGTGATGATTCTTTTGTCGGCCATAGGTATTCAAATTGGA AGAAAACAGGAAATTTTCAAAAGCATGTTGGAGGTTCTAATAGTGCCCACAATCAAGTTTGGAGCAAGTGTGAAGCTTTG ATGAATGAAGATCCAACATATTGATATAGCTTTTCAGAATTATACAAAGTAATCCCCGAAGTGAGTATCGAATTTATCTG ATGCATTAGTTGATTGTGTTCGATTATCAGAGATATTGGTAATGCATTGTTTTCGATTTTAGTTGATGAATTTCGTTACA TTGCTATGAAGGAGCAAATGGCTATTGTCTTGTGATATGTGAATAAGAATGTGCATATAATTCAACGTTTTATAGGTGTT CAACATGTCTCCAGTACTACAGCTCTCTCATTTAAAGCTGCAATTGATAAATTCTTTTCCAAACATGGATTGAGCATATC AAGATTTCGGGGACAGGGCTATGATGGAGCTAGCAATATGCAAGGTGAATATAATGGTCTCAAAACACTTATTTTGAAGG AGAATCCATATGCTTTTTATGTTGATTGCTTTGCTCATCAACTTCAACTAGCACTTGTGGCGGTGGCAAAACAAGCAAAT ACAAATTGCATCACTATTTATTACAGTTGCTAATTTGGTAAATGTTGTTGGAGGTTCATCTAAACGTTGTGACATTCTTC AAGAGAAACAAGCTGCTCTGATTCTTGAAGCAATAAAAAATGGTGAGATGTCTAGTGGTCGGGGTCTAAATCAAATGTAC AACTCTTAAAGCGTTCTGGTGTACGCGTTGGCGTCCGCATTATGATACCTTGATTAGTTCGATTCACATGTTCTCGTCCG TGGTTGACGTGCTTGAAAGGATTGTGGATGACAAATCAAGTTATGAACAAAGAAGTGAAGCAAATAACTTAAAAAAGGTT ATGCAATGATTTGAATTTATTTTCAGCTTACATTTGATGAGAACCATTTTAGGCATCGCAAATGAATTGTTGAAGGCATT AAAAAGAAAAGATCAGGATATCGTAAATGCAATGAATCTAGTGCAAATATGCAAGGAACAACTCCAAATGATGAGAGATA GTGGGTGAAATTCGTTTTTTGATCAGGTTTCTTCTTTTTGTGTCAAACATGATATTGTTGTTCCCAACATGGATGAAGTT TATTACTCGACGTCCACCCCAGCATAACGCATAAGAAATTACAAATTTGCATCATTTCAAAGTTGGTATATTTTATGCTA TCATTCACATGCAACTTCAAGAATTGAATGATCATTTCACGGAGGTAAATATAGAGTTGCTTCTTTGTGTAACTTGTTTG TGTCCTAATGATCCATTTTCTTCCTTTGACAAGAAAAAATTAGTTTGTCTTGCTAAGTACTATCTAGAAGATTTTTCTGC ACTAAACCTCATGAAACTTGAATATCAACTAGAAACTTATATTCGGATGTGTGCTCTAGTAAGGAGTTTGCAGGACTAGA GGGCATTAGTGATCTTGGTCAATCGAATGGGAGATTAACGGATGAATGAGAATTTGATTGTATACATCGAGAAAGATATT TTTGACACAATTGACAATGAAACTATAATGCAACGTTTTTAAAGTACGAAAACTCGTATACAAAAGTTGTAATGTTAAAC TTTGTTAATAATAGTAGTAAGACTTGATATTTAAGTATTCTGTTACTTTTTATGTTCTTAGTTGATGCCCCGAAATAAAA TCCTAACTCCGCCGCTGAATGTGACCTAATTAAACGATGAAATTTACTTGTTATATTCATTTATTTATGAGTGTGTTTCA AAATGATATATCCATTTGATTCTATCCAAGCAAGCAGTGAGAAATTCTATTAGT