>DTA_18_1_Mno length=2619;Class=DNA transposons;Order=TIR;superfamily=hAT; AAAGCAACATTTGGCTCGAGTATCTGGAGAAGTGACTTACTGCAATAAGGCGCCGGAGGAAGTGTACCTGAGAATGAAGG AAAATCTGGAAGGATGTCGTTCCAGCAAGAAACCGAGACATTGCGGAGATAATGGGCAGGCATACTTGAGCTTCAACTCC AATGATGATGAAGAACAGGAGGAGCTCCATGTTGAGTATAGAAGCAAAGGGAAACAATTGATGGTTGATAGGAACTTAGC TATGAAGTGCACTCCTCTTCGATCGTTGGGGTACGTTGATCCCGGATGGGAGCATTGTGTTGCTCAAGATGAGAGGAAGA AGAAGGTGAAATGCAACTACTGTGAGAAAATAGTGAGCGGAGGTATCAATCGGTTTAAGCAACATTTAGCAAGAATTCCT GGGGAAGTAGCGCCTTGTAAACACGCTCCAGAGGAAGTGTATCTTAAGATTAAAGATAACATGAAATGGCATCGCACTGG GAGGAAACAAAAACGGGGTGATGTAAATGACGTGTCGTCATTTTATGCACAATCAGATTCTGAGGATGAGCAAATGGAGG CTGGTTTGTGTCGTATAAGCAAGGAAAAAATGATCGACAATGATGGCAAAGTAGTCAAAGATTTGAGGAAGACTTTTAAG GGGATGTCTCCCACTAGAGGCTCTGAACCACTGTTAAAAAGATCTAGACTTGATTCGGTTTTTATGAATACGTTTATGGG GCAGACACCAGAGTCTTACAGGCAAGTAAGAGTTAAGACGTCGTCAAATAGAAAATCACGGAGGGAAGTTATTTCGGCGA TTTGCAAGTTCTTTTACCATGCAGGAGTTCCCTTACAAGCAGCAAATTCAGTGTACTTCCATAAGATGTTGGAATTGGTA GGACAACATGGACAGGGCTTAACTGGGCCTCCGAGCCAACTAATATCTGGCCAATTTCTGCAGGAGGAAATTGCAAGCCT TAAGAACCACCTAGATGAGTACAAGACTTCTTGGGCAATCACTGGTTGTTCTATACTGGCTGACAGTTGGAGAGATACAC AAGGAAGGACATTAATAAATCTTTTGTCTTGTGGACCAAGTGGTATGTACTTTGTTTCTTCCGTTGATGCCACTGAAGTA ATAGAAGATGCGGTCAGTCTGTTTGAGATGCTCGATAAAGTGGTGGAAGAGATGGGTGAGGAAAATGTAGTGCAGGTACT TGTGATTTTTGTTTTACCTGTCAACTAATTCTCCTTTGTAAACTAAACTATCGCCTTTGAATTCCTAAACTTTTCCCCTT TCTTTTTCTCTGCAGGTTATAACTCGGAATACTCCCAGTTACAAAGCTGCTGGAAAGATGCTTGAAGAGAAGAGAAGGAA CTTATTCTGGACCCCATGTGCAACTGATTGTATTGATCAGATGCTTGAAGATTTTCTGAAGATAAGATGTGTAGGGGAGT GTGTGGAGAAAGGTCAAATAATTACAAAGTTTATTTACAACCAAATTTGGTTGTTAAATCTCATGAAGAATGAATTCACT CAGGGGAAGGAACTTTTGAGACAATCCGTGACCCGATGTGCCTCTAGCTTCACTACCCTGCGGACTTTGCTTGACCACAG GATTGGTCTCAGAAGACTGTTTCAATCAAGCAAATGGGTTTCATCCCGGTGCTCGAAATCAGGCGAGGGAAAAGAGGTGG AAAAGATTGTTCTAAACCCTACATTTTGGAAGAAGGTGCATTTCGTTGTGAAGTCGGTGGATCCAATAATGCAAGTTCTT CAGAAGGTTGACGGTGGTGATAGCTTGTCAATGCCTTGTATGTATTATGAAATGTACAGTGCAAAGCTCGCTATTAAATC TATTCATGGTGATGATTCATACAAGTATGGACCCTTCTTGGATGTTGTAGAGAGTCATTGGAATTCATTGTTCTACCACC CTCTATATATGGCTGCTCATTTCTTGAATCCATCATATCGGTATCAACCTGATTTTGTGGCGGTAGGAGAAACATCAACT TCTGTTGATTTCCCATTTTTATCGGTTTCTCTCTTTTATATCCTGAAATTTATTTATTCCAAGTGTAGCATACGGAAGTG GTCCGTGGAGTGAATGAATGTATAGCTCGGCTGGAGCCAGACACTGCAAAAAGAGTTTCTGCATCGATGCAGGTACGGTA CCCCTTTGCAGTTCTCTGCGCTTTATTGTTATTCCTGGAAGGTTTCTCATCAGTTTTCTTAATGCATCAGCTTTCCGACT ATAATTCTGCAAAGGCTGATTTTGGTACTGAATTGGCAATCAGTACAAGAACAGAGCTTGATCCGGGTGAGTGCATTAGG CTGTTGAATTACTCAGTCTGGAAAATCAGGTTCTAGATAGAAATGCATCGATTCACATACTGACCAAAATCTTTTTTTCA TCTTTTTGTTTGCCTTGCCATATACTCACTAGCGGCTTGGTGGCAACAGCATGGGATAAGTTGCTTAGAGCTGCGACGGA TAGCTGTACGTATTCTAAGTCAGACGTGCTCGTCTTTTGGGTGCGAGCATAATTGGAGTATGTGTGATCAAATATATAGA CAGAAACACAACCGTATAGCTCAGAAAAGATTGGGAGACCTTAGCTATGTTCACTACAA