>DTA_17_1_Mno length=4572;Class=DNA transposons;Order=TIR;superfamily=hAT; TAGTGTTGGAACTTTGGGCCGGCGGGCAGGCCCAACTGCCGACCCGTCCAACTAAAATTTTTGGGCTCGGGCTCGGGCAT GTAACACCCTAAAGAATTAAATGAGATTAATTAAGGTAATTAAGATTTATTAGTGTGTCTGATCTGAATTAATTAATTGG TTATTAATTAATAAATATTTCTGACATGTAAATTTAAATAATTCCAAAGTATTTAAATATTCTCAGTATTTATATTTTTA CCCAGAAGTGTGTATGGGCACACTCTCTGGACTGTCATTTTAAATATTTTGACACATGTCTTTTCTTTTCTTTTCTTTTT CCTTTTTTCCTTCCTTTCCTTTCCCGTGCGCTTTCTCTCTCTCCACTCTCACTCTCACTCTCTTCGTTCACTCTCTTTCT CTCTCCCGTTCAAATCTTCACCGAATCTACCGGATTTCGAACCAAAGAGGAATTTCAAAAAGTTTTCAATGCCAAGAGAA TGATTCGAGATAAGATTTCTAAAAAACCTCTCTTGAATCTCGGATTTTCCATATTTGAAAACCTATTTTGGTTCAAAACA GATTTTGATGGATTTTGACTAAAAACATGGTAGAAATTGGGGATCTTGGGTTCTTTGGACTTGATTTAGTACCTAGAACC CGGATTCAGGTGTTGTCCCTTGAGATATTTTGATTTGGGACTGGATTTGCAGATTTGTTAACTGATTTTGTGAGTTTTCT TGCACTGCTGTTCTTCACCGGTCGACCGGATTGCATTGGCCTCACCCGTCGACCTGTTCGGTCGACCGAATTGTACACCA CCGGTCGACCGGTGGTGTTGCACTGCGCTGTCACCGGTCGACCGGTGTATAAGGGGTTTGACCCCGTTTGGCCTGAAAAT GCTGTTTTGACCTCAGTTTTTTAGGAGGACCCAAATTAGCTTCATTTGGGGACCTATAATGAATGGATTGGCATCTTTAA TCCATGTTTTGAGATTGAAACCCCTTGGAATGATGATTTGAAACATGAAATGGTTTGTGAAATCGGTAATTGAATTATAG CACACTAATAGGAAATCAAATGGTATAATTGAGATTGAAATTGCTTTAGGATTGAGAATTGGATCCTAAAGTGTGGTTTT GTATCAGTGCTAGCTGAAGACTCGGATTGAGGGGCTTGAGGAAGCAAAAGCCAGAATAGAGTAATGCTAGCCAAGTTTGG TACTTGCGAGGTAGGATTCCTTATTCCTATTCTTTGTGAGCTTGATTTTCAAAAGAGTTTTCGCCTTGCAAATGTTTTAA AGAAAAGGGCCTTGTTTGTGAAAGAAAAATGTTTAAAACCCATGGCTTGTTGTAGTTCATGGTACCTATGGCTTGTTGTA GTTCATGGGACCATGGCTTGTTGTAGTTCATGGTATTATAATGAACAATTTCAGAAAGTTTAATGAATGATTTCTTAAGA TAAGAGATCTTGTGAATCGGTAAACCGGCTGATGGCCAAGATAGGATGTGGAGAGTGCATCCTTAGGGGCAGAACCCGAA ACCCGGCCCGGGGGTGATAAGGCTTGTGCACGTGGTTGTGTAAGTAATTTATCGTAGTATAAATAACTTGCTGATGCCTG TAATACGGAGATTTTCAGTTATATTTCCTTTGAGAAAAAGGATGTGAGGTTCCGGCTGTTGTGTTGGAACTGAATGTCTT ATTTTATTTACTTATCCATTTATTTATTTACTCGCTTATTTATTTATTCATTTATTTATAAAATTTATTTCAAAATATAT CCTACTGGACATTTCGCTCACGTTTTTATTGTTCTATAAATATTAAACCCCTCCCATAAAATTCTAGAAGCGGTGCGGAG TAGCTGAGTTAGATTGCTACCACCAGAGTTGGTGAGGATTGTGTTCATCCTCCCTGTGCACGAATGTAAGAATTTGTAAA TTTTGTAAACGTTGACATTTGGATTTCTAGACTGTGGTTGATGTCTGTAATGTTATTTACATGTTCATGTATGTACAATG CTGAAGATCTTGTGGGTGTAGCCCTGAACAGTGTTAGAAGCTTGAGTTTTAGTCTCTCTCTTGGAATGTATAATTTAATT TCTGCTAAATAGTGGGGCTCTCCCTTGTATTATATTTTAATGAAACGGAGGCTTGTTTAAGAATTTACTTAATACTTTAT TTATGGATTTTGATTATTACTCCTAATCGAGCCTCCACGTCACCGACCCCTGCCCCGGGGCGTGATAGGGCAGCCCGAAA TGGACACCTCGCCAGAGCCCGTCGCCTTGTTATCGCCGTCTGCCGGAATTTTTTTAAATTTTTTCGATCAGGCCCGATTT GCCCGAACTGCCCTGAAGCCTGAAAACCCGACCAAGGTTTAAATTTTTTACCGTTGTAGCCTGACTTGACCCAAAACACG AAAAGCATAACCCCAACAGCTAGTTTTTGACCGTTGCCCAATTTTCTACCCGAATCCGACCCGCTGAAAACAAAACTAGC CGTTGGATCCGAATTTGGGGGGAAAAATCAATTTTTTAACCCAAAACTTTCCCTATAAATACCCCCCATCCCCCACACAT TTTACTCACTCAAACTCTCTCAATCTCTCTCAATTTCTCTCAATCTCTCAAATCTCTCTCACAATTTTTCCAAAAACTAT CACATTATCCTAGAGCTCTCTCTCTCAAATCGCTCTTATTTTTTTATAATGGATTCTTTTGGTTATAGTGGTATTCTCAT TGATAATACAATTTTAAATGTAATTGATGAATTTAAATTAAGAGATAAAGTAATGGCTATAATATTAGATAATACTAATG CCGATATAAAAGCAATTGAGTTCTTTGAAAATGATTTAAGTTTATTCGGTGAGTGTACTATTTTCCACCAACGTTGTGCA TGTCATGTAATTAATTTAATATTTAAATCTAGTTTAAAAGAAATGGGTACTCACATTAAAGAATTAGAGATAGTCTTGCA TGGATTCAAGGTAGTAACCAAAGACAAGAAGATTGGTTTAGGTTCTTATAAGCATTAAATATACCTCCTAGAGCATTAGC GTTAGATATGCCTGTAAGATGAAACTCAACTTATATAATGCTTTAACAATGCATCCCCTATAAGGATGCTATAACAAACT ATAAGTGTGTAAAATTAGGAGTATGACATATAGACGCATATGATTGGCAAATTGCTGAAATTTTTTTATGAATTTTTAGG TAGGTTTCATGAAGTTACTTTAAAGCTTAGTGGAACATATTACTCAACATCACCTTTAGCTTTAGGTGAACTTTTAAGAA TTACTATTTTATTTAGTGAATATAGGGAGGACCCAATCTTAAGAGTTTCTATCAAATCTATGGAAAAATAATTTAAAAAT ATTGGTCTAAGTTGCCTTTGTTCTATGGTTTAGGTACTATTTTTTATCATAGATTAAAATTAGACGGTTTAGAAAGTGGT TTAAAAAACTTAGGTGAATTTTTAGGCATCAATTGTTCGGACCAATTTCCAACAATAAAAGCAAAAATATATTCGATCTA TAGTAAATATGAGAATAGGTTTAGAAGCACAAACTCTAGAGTACAGGAACCATAACAACAAGATGAAAACCCGCATTCAT TCTTGAATGTTTTCGGGTTGAAGAAGACGAAGAAGACAACTCAAACAGAAGCTGGGAGTGGATCTTCATCAATAGGTGGC AGCGGCGGCGGCAGCTTCAACGAGCTTATAACGTACCTCAGTGAAAGCTTAGTAGTCAACGGTACTAGAGAATCGTTTAA CTTAGTTCAATGGTGGAGAGCACAAGCATTAATTTGGCCAATCCCAACTCGATTGGTAACAGATATATTTTCGATCCCAG TCTCCACTGTTTCATTCGAACAAGCCTTCAGTATGACATGACGAATACTTGAGGAACGCCGAAACGCATTGTAAAGGGAC ATTGTTGAAGCCTTGGTCTACATTAAGGATTGGAATCATGCCGATTAACGTCTACATGATACAATTTCGCCGGCAAGTCA AGAATAGATCGATGAATTTAATAGATTAACATTTAATTTTGAAGACGATCCTTCAGCTTCAAATTAAATTATAAATTTGT AATTTGTAAATATATATTTACTTTTGACATTGTAATTGTATAACTTTGTAAGTTTGTAAAATTTGTAATTCGTCACAAAA TGATTGCACTCTTTTTTCTTTACCAAGTTTTTATCCCAATTAGATTTTTCTTGGTAAGATTTTTAACGAGATAATCATGA ATTACGAATTTAAAAATTAATATACAAAAATAATTTATTAAATTGTGTTAATAATGTGTGTTGAATGTTGATTTTAGTTT TTATATAATTTTAACACAAAATAACTTAATAATTATAAAAATTAAAAAATATTTAAAAAAATTTGAGCATTTCGGGCGAG CTAGGGCTGCCCGGCCGGGCTTGGGCAGCCAAATACAGCCCGCGGCCTGTCCACAAGCCTTCTCGAGCTTGGGCGGGTGG CCCAAAAATTTTGGGCGGGTCGGGCCGGATATCGAGCAAAAACTCAGTATTTTTAAGTGGTCGCGGGCGGCCCGTCTAAA GTTCCAGCACTA