>DTA_16_1_Mno length=3058;Class=DNA transposons;Order=TIR;superfamily=hAT; ACAATGTACACAGAGGAACTCAAAACCGGCAACATTACTCAATTCAACAATCAGAGGAACTTTCAATCAATTCCTGAGCA CACAGAGGAACTCAAAACCGGCAACAATGTACAAAATTTCAATTCCCGTTGATGATGATTCAACAATGTCCAAATTTATA GAAAATCAAAACCGTAAACCCATTTCCGCACAAATCAGACCCAATCTAAAAATCGGAGGAGAAATCACACTAAAACCCAA TCTAAAATCAGACCCGATCGTTTTCTTTGATTGCAAAAAATCAAAACCCTAAAACCCAAAATACAGGCGGAATAAAAATC AAAACGAAATCCAAATGTTCAAACCAAAAAATTTCGCACGGTTAGAGAGGCTTACCTCTTGAGTTGATGATGATAGACGG GCAGTCGTCGTCGGAGGAGATGGGCGATCTGCAAACGGACAATCACGCGGAGGAGAAACCAACCGAGCTCCGACTGGCGA ACGGAGAGAGACCGGCGAACGGAGAGAGAGACCAAACCTCAAACGGAGAAGAGGGGAAAGGATAGAACGCACAAGAATTT TTTGTTGCAGGGGACGAGAGTGATTCTGGAGGAGGTGAGCGGAGGAGAGTCGGGGGAGATAATGAAAATGAAGTTTGATG TGGTAAATTTTAACTTTCATTGAGGGTAAAATTGGAAATAGAAAATTTCATTAAAACCACAAAATAACTTCCCGCATAAT CTAACATCAGAATCAGCCTTAAGGCTGATTCTGATTTTAACTTCAGATTGGAAGAAAATTATTCAACAATCTGTTTTACC AAACAATTTTTTAGATTTTAGATGTGTGAAAAAGTGCTTTTTCTCTCCTAAAATCAATACCAAACCCACCCTTAGTCTTT GGCAGTGTTGCTTGTCCAAAGTTTGATATTCCATCACGCGTAACTAGTGCAAGAGATGTTATGAATCTCTACGAGGGTGA GAAAGAGAAGCTAAAATCATTTTTTAAGAAGAATTCACAAAGAATTTCTCTGACCACCGATACTTGGACTTCTCTTCAGC AAGTAAGTTACATGGTTTTAACTGCTAATTTTATAGATTCTAAATGGACAATGCAAAAGAGAATTTTGAATTTCATCCAA ATCCCCAATCATAAGGGTGAAACAATTGGGAAAGCAATTGAGGCATGCTTACAACAATGGGGACTTGAGAAGATCTTTAC AATCATAGTGGATAATGCTGCGTCTAATGATGGAGCTATTGCGCTCATGAAGAACAATGTTAGACCTTGTTCATTTGATC AATTTAAATTTAAAATTTGAGTTTTACTATAATAAAAAGTTCTAAAAAACAGTCACATTTAACTTTTTTGCTCAGTAAAA AGCACTCACATAAAGTCACGTTTCAATTCGAATTAAAAACTTGAATTAGCAAACTAAACGAACCCTTAGTTTACCACTCC ATCCTAAAAGCTTAAGCTGTTAGGATGTGAACTAACAATAGTTTTAATACTTTAATACTCTCCCTCACGTGTGGACTGGA CAATGGGCAATCGTGTGGGTAAATTAATTAAAAAGCTCAACACGTGAATATTTAAGCTCAAGATATATTACAGACCTAAC ACATGATGACAATTTAAATGAGGATAAATAGTGTAATTACGAGAGTTTAAACTCAGGACCTCCTGCTATGATACCATGTT AGTTTATTAATCTAATAATAGTTTTTATACTTTAATAAAGAGACTTTCTATTTGGAATAGTGGTGTTTGTGATAGGGAAT ACTTACATGTGAGATGTGCAGCTCAAATATTGAACCTAGTTGCGCAAGATGGTTTGAAAAGTCTACACATCTCCGTCGCA AGCGCACGCAATGCAGTAAGGTATGTTAGATCTTCACCTGCAAGGTTGGGAAGATTTAAACAATGTGTTAAAAATGTGAT GCAAGGTTGGGAAGATTTAAACAATGTGTTAAAAATGTGATTAAAGGAGATAAGGCCTTTGTGTGTTTAGATGTGCCAAC TAGGTGGAATTCTAACAATTTGATGTTAGAGCATGCTTTGAGATTTGTGGATGCTTTTAAACTTTTGATGGAGGAGGATG GACACTATGAGTTATGGTTTATGGAGAGAGAATCTAATGGGAAAAAAGGAAGATTGATAAAATGAAGTGAAAGCAGCGAC TCAATTTTGCAGGACATGGCGATAAAAAATGAACTTGAAATATGATAAGTATTGGGGTAATGTTCACAAGTAGAATAATC TTTTCTATGTAGCAGTTGTGCTTGATCCAAGGTTTAAGTTGAGTTATGTGGAGTTTTGCCTTCGAAAGATTTATGAGGAA ACAGTTTCCATTTTGCTCACTACTGTTAAAAGTATGTTAGCAAAGTTGCATGGCTTCTATGCAAATGGTAGTTCCAAACA ACAGGTTGTTGGGGAGTTGAGAACTGCTGATTCAAGTATGGAAGTTGATGATGATGGAGACTTCTTTCAACAAGAATATG AGTTGCAGTGCTCAACAATCAATGCGTATGATAAGTCAAGTGACCTTGAGAGATATTTGGCGTAAACCGATGAAGATCGA AAGAAGAAAGACTTGGTTGTTTTTTTAGAGTGTAACTTGAGTGTAGTTTTTGAGTTATAACTTGAGTTGAAGTTGTAACT TGAATAAAGTTGAAACTTAAAAAAACGTGAACTTAAATAAAATTGAAACTCGAGTTGTCTTTTTTTGAATTTTTTGGACA AAAGAACATGCCCTTTGATATTTTGAGTTAGTGGAAGATGAATGCTTCTAAGTAGCCTATTCTAGCAGACATGGCACGCG ACATCTTAGCGGTTCAAGTGTCAACTGTAGCTTCTGAGTCACCATTTAGCACTAGCAGTCGAGTTCTTGATGCCTTTCGG AGTTCGCTGAGTCCATCAATAGTGGAGGCATTGATTTGCTGTTAAAATTGGTTAAGATCTACTAGCCTCACACTAGATCT TAAACCCCAATTAGAAGAATTAGAAGCTTATTCAGATATTGAGTCAAGTAACTTTTTTTTACTCTTGAACTTTATTATTG TTGCAAAATCAAATGTGT