>DTA_15_1_Mno length=6078;Class=DNA transposons;Order=TIR;superfamily=hAT; TAATGGCTAATAAATATCACGATGAAAACTATTCTTTCCGTTTAAACTGGGGTATAAATACTACCTTTATGATGAAATTA TGTGTAGATTTACCTTTACATTATACATGCAACCATGAAAATTGCAGCTTTCATCTTTTAAATAATTTTTCATCATACTT CATAAAAATATCCATCTAAATCTAATGTATCCTTCTGTCAGAATTATACTTCTTCTAACATATAAAAGTTAATTAACTCA AGTGAGAGGGTGCTTGGTTTGCTCTCTCTCGCGACTGAAGCTAAAATTTATATGGATTATAAGTAAACGTTGTTTATGTA GAAATACATTTGATAATAAATTAATTTAACAGTGTAATTAAAAAGAATATTTTTTTATAACTATAAAAAAAGTATTTAAA TGGGATATTTGAAAATATATAAAAATAAAAAGTTAAAAGATACAAGAAAAAAATAAGGAAGAAAAAAGAGGAAACTGAAA AGAAAAACTAAAAGGAAAAGCTTAAATAAAAAGAAAAAAAAGTGGGGGCACGAAACCAATTCTGACTTAGTAGTATGGAA AATAGATAGATTGAGCATCTTCAATGTAATACTATAATTGATGTGTCAATTGTAAATTTAGTATTTGAGTGTAAAAAAAC TCTCCAACGCAATGCTATTTGTTATGCTAAATTTCTCACATGCTATACTTTGTAGTACATTTCTCACCAAGTATAGCATA TGAAAAATTTGACATTTGATTGTCATGGAATGTTTACTTTTTTTCATGTAATCATTGCAACTTTTGTAATTTCTAATTAT TTTAAAAATAAAAGTTTACTTTTATAACTTTCAAGATTTAATAGTTACAAGAAAAAGTTGATTTAGCATCTCAAATAACA TTATGCATTGCAGTAAGAATGAAAATAACATATCATATCATACTTTTTTAATGTTAAATATACAATTATTATTAATATTT ACATTAGAAATAGTCTCATGAGTGATCATATTTGCTACATGGCTATACCTCCCTCGATGAAATTGTGGCAGTCCGCTTAT TAGGTAGTTATGATATTTTTAATTTTGTTGTTTATAAATGGGTAGATTTATTGTCAAAGTTAAGAAAAACGAAAAAAAGG AACCCAAAACCCTCTCTGAAGCTAGCTCCGTTTCTCCTCCCTCACGAAGTGCTCAGTCATGGCAACTTTTTTTTGATTTC TTCACATTTATTCTCCCTAGCTATTAAAGCTCTAGATCCGCAAGATTGAAGAAATTTTTGTCATATTTTGTTTGATTAAG TGCTTTGAAGAATAATAAATTATTAGAAGAACTTTTTGGAGAACAAAATTTGGAAACTCCAGCATAAGGGAAGAGGAGAT CTTGGAGGTTCTGAAGGGGGAGAGAGAGGGGGATGAGGATTTTGGGTCGTTCTCTTGTCTTCTTGGTCATTCGTGAGGGC TCAAAGAAGGGAGGAGAAGGAGGAGAGCTCGAATTTGGTATTTGGCCTTAAGAAGGATGGCACCTCTGTTAATAATACAT ATTAATTATATAATTAAGAATTTATTTAAATAAAATAAATAAAATTAAAATTAAAAAGTCATTTTCTTAATTTTACTTTT TTACTCAGTTATTTTAGCCAAATTCTCGCGGTTTGGGAAAAACTCAAATTTATAATCATTTTAATTGGTTGGCAAGATGG TTTGAGACTAGCAAACGCGAGCGGTTTATGCCTAATTAGAATTATGTTGGAAAATGCATAAAAAATATATATGAAAAACA TAAAACTCATTCTGTTGTTTGTTTTTTGGATAATTATTATCTACTTACTATCTTGTTTAAACTATAAAATGATTATCAAC ATCAAACAATCATCATCATAATTCACATTTTATAAATTATGTTTCATACTGTATAAATTTTGGGCGGTTTGAAACCGCAG TTTGGTGGGACGAGGTGGCACAGTTTAAGAAAAAAAAAAAGCTAAAACCACCAATTATGAGGTAAGCGATTTAAAATTGA GGTTTGATAGTTTGATGTCGTGACGTAAAAATAGCAGTGTGAGATTGTGCAGTGTAGGTAGACGAGATGGTTTGATATAT ATATATATATATATATTGGTAGCTTTAGTTGTAGTAAATACTTCTAGTGATTAATGAAATTCAGTATCTCTAGAAAAAAA AAAGGGAGATGTGTAAACTAACAACCAAGTATAAATATTTAAAATTTGACCTTTAAATTTTGAGTATTTTACACATTTAT TTTTTGAATTTGTATAGTTTTAACAATTTGCCATCTAAACTTTTAATTTGACAAGTTACCCCTTCAACTTATAAAATTAT TATAATATGTCTTATTTAGACGATAATTGTATTAAATTAGTGTCAAAAAATCACGTTCAATAAAAGATTTTAATATCTCA ATTCAAATGTAATAAAATCTTTTAATTTATCAACTTTTAATCCCACAATTCTAATAAAAATTTTGATCATAATATAATAA TTTTACAACTTAAAGAGATTGATTGTCAAAATTAAAAATATAAGAAGTAAGTTGCTAAAACCCAATAAATTAAGGAGTAA TTGTTAAAAATCCTTAAATTCTTTTCGTGACAAAAGATTATGCTCAAAATCATATTTACAAGATTACCCACTTCTTAGTC GTCGGATTACACGTGGCATATAACTATTGGTTCTTTTACAAAGTTGTCATCCTCAGCGTTACAGCACAAGAAACTACGCA TAGGCTCACAGGTCTAAAAGGACTAGATTCAATCAGGACTCTGTAGGCTCATCGGTGGCCGCAGATATCGATCAACTCTG CCATCAAAGCACTTATTTTTCAATATAAAATGGACCCCAACACTATACCTAACAGAGTCCAAAAACTTTTTTTCTTTTTT TGTTTTTTTTGTCGCCGTCATTGTGCTGCCCTCCAACTAGGCCCTAAAAAGCTCAGAGCCCTAATTCTGGTCCATTAGGG TTTGCCTCCAAAGCTCTAAACTTTCAACCCCAATTTCAAGCCCATCAACTCCGTCTTCAACCTCTGTTTTTTTCAAAATT TTGAATTAAATCAATAAAATACACGATCCCTCCTTTTTTTTTTTCCCCCCGATTTGCAAAGGGCGCCACTTTGAATCTTC AGATTGCGATTCTCGGTGAGACTTTCGAACTTTTCTCTTTTTATTTTCTTTTTTGCCCTTTAAGATGTAGATTCAATTCG TTAATTTTTCTTCTCCGTTTGAATTTGTTAGTTTTTTTTTTAAATATATATATGTATATTTAATTATGGTTTTTTTCTCT GTTTAACGTCGTTGATTTAATGGGTGATAACTTTCTCTCTTTTATTTATTTATTTTTTAATTTTTTTTTGGGTTTTAAAT GCTGTCATTGTATCTTTGAACTGGAAATTTGGGCATATTTACTTTGAAATTAGGCCAGAATTCCGCATATATTTGCAGAA TTACTTTTCTCATTTGTTTTTTCAAGCCAAAAATTGTATATACGAGGAAATTATATAGTCCTACATTGTAGCTTAAGACA CAAGTAATGTTAAAGGTCTGTGTTTGCGGATAGAGCCGTTCTGGTTTGATTATCCTTAGAAGGATTTGATGTGTTAAGTC TATATTTGTTGTTAATAGGACTTTTCAAATGTCTCTTCCTATCGATAACCGAGTGTGCAAAAGGGCTTATAGAAAAGTGT ACAATTGGTTGACATTTTACGCTCCCGGTCTCTACCCAAAAGCCGCTTGAATGTCACCAGAATTGCTGCTTGATTTTCAG CCATTATTCAATTTTGTGTGGTTTGTGGGTTCAATGTGTTAATCTTCAGTTGTGATTTTATATCTTTTGAAGCGGAAACG ATCCCATAAATATTTTAAGTGTGTTTTGATCTTTCTATTGCTGATTATTATCTCTCTTTCCTGTTCTTGGATTAAATCTA AGATCCTGTTCCCTGCGGATGGATACTCTTACAATAGTGCCAATCGAAAACAGTGAGGTAACCATAGCAGAAATACAGCC CAACAAGCGTCGGAGGAAGAAATCTGTTGTATGGCAGTACTTCACGGTGGAAAAAGTTAGTCCTGATTGCGTTAAGGCCT GTTGTAAGCAGTGCAAGAAAACCTTTTCTTACATTACTGGTTCAAAGGTAGCTGGAACCAGCCACCTCAAACGACATATT GACCTTGGGATCTGCCCGGAAAGTCGTCAGAACAATCAGCAAATTGCATTTACACCTGGTTTACAGACTGCTGCTACTAA TCGCCCCAGGAAACGCGTCAGGGCTTCCTCTGTAGTTCCAAGCTCCCATTTTGACCAGAATCGCTGTAGTCATGAGATTG CTAAGATGATTATCTTGCACGAGTATCCACTTCATATTGTGGAGCAACCTGGTTTTGTTGATTTTGTTCGAAAAATTCAG CCACAGTTTAGTATGCCAAGCTTCAATACTGTTCAAGGGGATTGTGTGGCTATGTATCTGAAAGAGAAGCAAAGCCTTTT GGATCTTGTCAATGGGATTCCTGGAAGAGTCAGCCTTGCATTGGACGTGTGGATTTCAGATCAAACCCTGGGCTATGTTT TTTTAACAGGGCACTTCATTGATGCTGACTGGAATTTACACCGCCGGATTCTTAATGTTGCAATGGTGCCATCTCCTGAT TCAGCAGACTCTTTCAATCAAGCTATTGTAGCTTGCCTGTCTGATTGGAATTTGGAAGGCCGGTTGTATTCCCTCACACT CGATCAGTCGTTTCTGAATGAGACGGCATTTGATAATCTCAGAAGCTTTCTTTCTGTAAAGAATCAGATCCTGCTGAATG GTCAGTTATTAGTCAGAAATTGCTTTGCTCGTGTTCTTAGTCAGCTTGCACAAGATGCTTTGGGATTAATGAGAGAAACT ATTAGTAAAATCCGTGATAATGTCAAGTATGTCAAAACTTCAGAATCACAAGAAGAGAAGTTTTTAGAGCTAAAGCAACA ACTCCAAGTTCCTAGCATGAAGGAACTTTTAGTTGACGACCAAACTAAATGGGACACCACTTATCATATGCTGGTGGCAG CTTGTGAACTACGAGAAGTCTTTGCTTGCTTTGATACTTCGGATCCTGATTACAATATAACTCCATTGACAGATGAATGG AAGCAGGTAGAAATTCTCTGCACATACTTGAAATATTTGTTTGATGCAGCTAATGTCTTAACTGCCGCAACCTACCCGAC TGCAAATGCATTTTTTCCTGAAGTGTCAAAAATTCAAATGGATTTGATGGAAGCAGCCATGAGCGAGGATCCATTTATCA GCTACTTGATCAGACCTTTGCATGAAAGGTTTGATAAATATTGGAGTAATTGTTGCCTGGTTTTAGCGATTGCTGTAGTT ATGGACCCGAGGTTTAAAATGAAGCTTGTGGAGTTTACCTTCTCCAAGATTTATGGTGAGAATGCTGAGACATGGGTTAG GATTGTTGATGACGGCATCCATGAACTTTTTATTGACTACATGACGCAAATGCTGGCGCTACCGGAACCAAGCATGGACA ATGGCAACGAGCACATGATTGATTCAGAGACACATCAAGAAGATGTCCATGATTATGAAGGTCCGTTTATTTCTACTGGT GACGGGCTTTCGGATTTTGAAATCTATCTCTCCGAGATTACAAGCAGTCAGCAAATGAAGTCAGAACTAGATCAGTATCT GGAAGAGCCACTTCTTCCCAGGGTGCAAGAGTTCGATATTATGAGTTGGTGGAATCAAAACAGATCAAAATACCCAACTC TATCTAGGATGGCTTCTGATATATTGTCAATTCCAGTTTCCACCGTTGCTCCTGACTCTGTGTTTGATACTAATTTAAAG GTGGTGGATAAGTACCGGAGTTCATTGCATCCAGTGACGCTTGAGGCCCTTATCTGCGCAAAGGATTGGCTGCAACATGG GTCGTCAACCCAAACGCCTTCACCGTCGTTTGAGGTTACAAATGCAATTGTCAGAATGGAATTTTAGATTTAGGTTTAGT TTGTATTTTCTTCCTCTAGGTAGATCATTGAATGCCCTCATTTTGATTGATTTTGAGGGCCACCAATGTTCGTCATTA