>DTA_14_1_Mno length=3211;Class=DNA transposons;Order=TIR;superfamily=hAT; GTGATTACTTTTGAATTATAATGGTTAATTATTGAACTTTGAAAGAGAATTGTTGAATTGTTATTACTATTATATTTTAG AGAATAGAATATGATTACTTCTTTTAGAGGAAAAGATTTGATTAGTCAAAAACCGTACACTCATAATGTTCACTGATTTC ATCCCTAGTGTATGAAAAAATAAAAAATAAAAACTTCAACATGAATTTCTAATATTTAGGTGACAATTTATTGAACAGGT ATGAAGAGGTATTCTAAAAGTTTGTCAAAGGACTCTGAAATTCCTACGGGAAAAAATGGCAAGAGTGCTAAATCAAGTAA GTTGGATTTTGATCCTAAAGAACTACCAACTGATCCTGGGTTGTGAATTCCAATTTTAGAGTATGGTCTGAACATCCGTG ATCAAGTTCGACGACTGTATGCGCAAAGAGGTCCTTATCAACCTACAGACCATAAATTTCCATTGACCAAATTTGGGAAA CAATCAAGAAAATTCAACAAAGATTGGTTTGAAGAATTTCCTAATTAGTTAGAATATAGCGTTGCAAAAAACGACGTATT TTATTTGTGTTGTTATCTTTTTAAAAAGAATGATAGAATTCATATGCATGTTGGAGGGCCTTATAGTGATCATAACCAAG CTTGGAGGACGTTTGAAGTCTTGAAGAGTGAAAAAACAATATCTTGAAGGATTTTTCTTAAAGGAATCAGAAAAGTCGAG AAGTGATTATCGACACCGCTTGAATGCATCAGCTGATTGTGCTCGATTTCTTTTGCGGCAAAGCCTTGCTTTTCGTGGTG ATGATGAATCTAAAAATTCATGCAATCAAGGTAACTTTCTTGAACTTCTACAGTTTTTAGCTGATCCCAACGATGATGTC AAAGCTATTACATTAGGAAATGCTCCTGGAAATTTGAAATTAACATCACCTGATTTTCAAAAAGATATTGTGAGTGCTTC AGTGGCTGAAATTATTAATGTTATCATGAAAGATATTGATGATGTAATGTTCTTTATTCTAGTTGATGAATCAAGAGATA ATTCAACAAAAGGAGCAGATGACTGTTGTATTGCGTTATGTAGATAAGAATGGGCATGTGATTGAACGTTTTGTAGGGAT AGAACATTTTGCTAGTACCACAGCTTTGTCGCTAAAAGCTGCTATTGAATAAATTGTTTTCTAGAAACAAATTAAAGCAT ATCCAGATTACGGGGACAAGGTTATGATGGGGCAAGTAATATGCAAGGAGAGTTTAACAGTCTTAAAAAGGAAAATCCCT ATGCTTTTTATGTTCATTGTTTTGCTCATCAACTTAAACTTGCTCTTGTAGCTGTGGCAAAGAAACATATTTAAGTTTTA TAGCTTTTAAACTCAGTTACTATTGATGGTGGATTTCAGTCAACAAGGAATTAACTCTCCGAGAACACTCGCAATAATCT CTCACGTGTTAATTTGGAGTTAGTGATGCTGAATAAGTAAATGAGACAAGAATTTATAGTGGTTCGGCTCAATTTTTTTA CCTAATCCACTTGTAAATGCACTAATGCTTTCTGATTACAAACTCTCTCTGGAGTAGTATAGTAGTGTGCGTAAAAAACT CAATGAAAATCCCATGGCTCTATTTATAGGCCTTATACATGTGAGAGACCCCATGCATTTCCCGAGGAGATCATCCTCTA TCCCTTAAGTTGGGGATTTGGCAACTAGATTTCTATGATTTCTGCTTCCCGGTCAGGCTAACCACTCTTACCCAATACCT GATTTCCTAACCTCAACAGTGGCGGTAGTTGATACAGTGTCTCTTTCCCTGGACTAACAGCGGATTTGACCGGGCTGCTG CCTCGATGTCGTGGCCCTCGCCACCTGGGCGGGCTCTCGACGTGCATTGGCATACGCGAATCCTCGACGTATAAAGAGCA CTCTGGACACACTGGTTGCCTCGGCATCAATGACCGATCATCAACAGGGAGACTTCGGCGCTTGTCACCTAAAAGAACGG TCAATCCCTCGACCGTGGTGTAACGGTTACTATTGTAGTACATGTTGTTGGAGCTCCACCAAAATGCTGTGATATTTTTT GAGACAAACAAAAGGCCATCATTGCTAAAGCAATCAAGAATAATGATATCTCAAGTGGACGAGGCATAAATCAAGAAACT GCTCTCAAACGTTTAGGTGACACACGTTGGGGCTCACATTATGATACTTTAGTCGTGCATAAATTAATGTATTTTATAAA GTATCTCAAATGTTTGTTAAAAAATTGTGTTATACACGATCCGCTAAACATGTGCTTCCGCATAGAAATCGTTTTCAAAA CCAACATATATATGGTTGTTACAAAATTTTCTAAAAGTGCACAGGTCGCAAAACTAATAAAGTGACTAAAAAGTCAAATA TCGTCCTATAACAATTGATTTTTCAAGAATTAAACTAAGTACCGTGAGTGATCGTGACTAAATTTTATTTAGGCAACTAA AATTGAGTAATTAAATATCGAAACTATGAGTGGAAATAAAAATAATAATAGAGTTCTAGGGTCTTGACTTCGCTTCGCTC TCCCTATGTCTTCTTATTTAGTGGTTGCTAATTAATTTAACTTAATTCATTAATCTAAACATTCTAAATTAGTCTCACTA CCTCTCCCAGGTGTCAAGTAAGACAATATGTTCAAATAAACAAGCCAATATTCCTATCTAACATGGGTATAAACACATTC ATTAAGCTCAACCTTTCAATGATTATCTAAGCATTTGATCACCTTTCGGTCTCACAATTACCAAGATTCTCATAACGATT ACCTACGTGTTGATCACCTCCTGGTCTCATAACAACATTAGATTGTGCTTCCCCATACTGATATTCGAACTAAACTCTCC CGAGCATCAACCAAAGTATCAAAGAAACAAGTCTTTCCAATCAACTAGACGCATTAAGTTCAAGAGAAACACAAATAATT GAGTCAAGATTTCATTAAAAAGCAACTAAATATTCACAACATAGTTCAAGCTAGCTACATCAAGGCCTTAGTTAGAAATC TAGCCGCACATGCTCAAATCCATAAGCATAGTCATCATGAAAACCATAAAAGCAACCATGTTGTCACAATATCACAATTA TAATTTTCAAATTAAAATCAAAATAAAAAGAGTAGAAATTAAGAGAAAACTATAGTAGAGTGGTCTTCAATGCTTCAATT TTCAAGAATCT