>DTA_12_1_Mno length=4570;Class=DNA transposons;Order=TIR;superfamily=hAT; TCAATTTTTTAACCCAAAAATTTTTCTATAAATAACTTATCCCCCACACATTTTCCTCACCCAAACTCTCTCAATCTCTC TCAATCGCTCTCATTTTCTCTCAATCCCTCTCAATTTCTCTCAATCTCTCACAATCTATCTCAATCTCTCTCAATTTCTC TCAATCTCTCTCAATCTCTCATATCTCTCTCACAATTTTTTCAAAAAACTATCACAATATCCTAAAGTTCTCTCTCTCAA ATCGCTCTTATTTTTTATAACGGATTCTTTTGGTTATAGTGGTATTCCTGTTGATACCCAGCACAACGTGGAAGAAAGGT AATTTCCCACTAATGAATTTATTAGGCAGGAATCTACTAATTCGAGCCCTGGTGGACGTACTGAATGACGTGATTGCAAT GGTGGTGGGTGTGGAGAAGCGGCGAGTGCAAATATTATTAATCCGAGCCATGGTGGATGTACTGGAGGTAGTGATCGCAA TGGTGGTGGGCGTGGACGTACTGCGTCTGCAAGTGTTGCAACCTCCAAGAGGAAATGCAAATGCACCTCAACAGTTTGGG ATCACTTCGACACAATTGAGGAGATCGACAATGAAGGTAATACTAAACATATTGTTTAGTGTAACTATTGTTTATCCAAA TTACAATTTGATACTATTCACGGCACAACACACTTGAGAAGACACTCCGAAAAGTGTCTTCAAAAGCTTAGCTAGTCCAG CGGAGCCAAACTCCGCCAAACACAATTATGTTTTGATCGCGCAACCGGTGGTCTAACCACTTAGAAATACGATCCGCAAG TAGATTGTATGGAAGTTGCGCGAATGGTAGCAGCATTAGATCAACTACTTAATTTTGTAGAGCATCCTAATCTGCAACGA TATATTAAAGTTGTATATAATCATACTGTACAGTTCACTTCAAAAACTACTCTTAGGAAAGATTTATTAAAATTATTTAA AAAATGAAAAGAAGCATTAATAAACCTTTTACACTCGACTAGCGGTTGCGTTGCGCTAACGGCATATATTTAGTCTGCTG TTGCCAATAAAGATTTTTTATCTATAACCAGACATTACTTTAGTTTTAAATGTGTTTTAGGATCACATAACGCCGATTTA ATATATAATACAATTTTAAATGTAATTGATGAATTTAGATTAATAGATAAAGTAATGGCTATAACATTACATAACGCTAG TGCAAATACTAAAGTAATTGAGTACTTAAAAAATGATTTGAGTTTATTTGGTGGTGGTTCTATTTTTCACCAACATTGTG CATGCCACGTAATTAATTTAATAGTTAAATCCGGTTTAAAAGAAATAGGTACTCACATTAAAAGAATTAGAGATAATATT GCATAGATTTAAGGTAGTAACCAAAGAGAACAAGATTGATTTTGGTTCTTACAAGCATTAAATCTACTGTTGGTTTCTGA GTCGAATTTTGATGTGGAAGCGTGAGGGTAACGGATCATGTATAACAAAAATTTTCTTAAAACTCTTGAGATACTCTATA GATTATATTAATTTATGCACAAATAAATTAATCACATTAATTTATTTAATAAGAACTCAATTAGAAATTATACCTAGCTA CCGGTTAGTATGATAGCTTGAGTTCTTTGACCACGAATAATCCTTACGCCAAAGCCTTGTGTTTAAAAAATCAATGTCTT CCACGTCAATTCTTAGAACCCCGAAGACGTGTGTGTGGGCACACCTAAGACAAAACAGGTTGTTATAAACACTCGAATTT CCACAAACACCAACACATGCACGTTGTGGAATTTTTGGAGAAAATTTTTTCCTCTCACTCTTTAGAAAAATTCGGCCACA CTCCTAAAATTTGGTGCAAAAATTGTGTCTTACAATTTTCTACTATTCTCTTATTTATAGAGTAGAAGTCAAACTCCTAG AAGGAATCCAATTTTTATCTCTAAGATAAAGCTTGTTAATTATTTCCTATTTGAATTTGGAACAAAATCTCCCACTTTCA TATCCTAGGTGTGGCCGGCCATGTATGGGGATTCTTATCCCTGTATGACACCAATTACAGATAGGGAAGAAAGAGAAAAT CATCCTTTATCCTACAGTCCAATTTTGAATCAAATTCAAATTCCAATTTAAGTCAAACTAAAATAAATTTGAATTCTAAA TTGAATAATTTATCAAAAAAGTTTAAATGGATAAATCTAGATGTGTTCACACTGTGTGTTTACACTGTGTGTTCACACTC TGTGTTCACACTATGTGTTCACACTGTGCCTTGTGTTCACACTATGTTAACACCTTCACATAAGTGATCCAAAATTCAAA TTCAAATTTAAATAATCAAATTATTTAATTTATAATTAACTCTTAAATAATTATTCTCGAGTGCTTAATTTTAGAATTCT GTAATTCTAAAATTCTCATTTTACCCTTTGTGTTTTGTAGAATTACTAGGACGACGCGGGAACTAATGGACCTATAATCC CGAGCTCCAATAAAATTAATAATTAATTAAACACTTTAATTAATTAATTAATTCTAATAGTTACTCCACTATAAACTTGG AATAACACTATCGAAATTATAGACATAAATTACTTCTAAATTGTGAAGTGTCCATTTGATATAGTCACTGCATATAGATT AATCCTCCATAAATAATTCATAATTAGAGCTAGGTAGAATCCGTTAACCTCTCTAATTATATCTTCATTCTTGAGTACCA TTGATTCTCTAATGGATAGTGATTCATAATACACATTCATGAACCAGAGCGCTCTTACTAATCCAAGTACCGAATCAACA CTCAAGGGAATTATTTATCTGCTTCTTTCTCAAGAAGGAATGGATTCCATCTCATATAATAACATTCCCGGCTACCTACT TCATCATGTCTCCAAAATATAAGGAATAGGATTCAGGGTCTCAGAATACGTACTGAGTAAATTAAAAGACACAAATCCAT AAATAGGAGTCTGCTAAGAACTCATGATTAAGATCAGTCTATATATGACCATCGGTAGACTCAATTAGAATTTCTATACT TAATACACTCATTAGAAATTCTTAGAACTCAGAAATTATTAGAAATTCATATTGTGTCTGTGTCCCTGTTCCACATAATC TCATTATGCGTAATACACTCATTCAATATCTTGTCATATTAACAGTGCGGATAACATCGTTCCATTCTAAATGTGAATGA CATGTATTAGTAATGTTGTAATTAAAGATTCTAAACTTTAATTAAATTAATTACGAACATTACTTTTTGATTATTATCCT TAAACATTATCCTCCCGCATACAACACTTATATACAATGGTTAAGGTCACATAAATAATCACAAAATATTAATTTGATAT TCATAAAATATTCACAAATATATACACATAAAATGATGAATAAACTCTTTTATTAAATAAATAATAAATATCCTATTACA TCATATGCTTCTAGGACACCATTCCCAACATCTACCTCCTGGAGCATTAGTCTTAGATATGCCTGTAAGATAGAACTCAA CTTATATTATGCTTCAAGAATGCATCCCCTATAAGGATGCTATAAGAAATTATATCTGTGTAAAATTAGGAACATGACAT ATAGACACATATGATAAGCAAATTGCTGAAGTTTTGTATCAATTTTTAGGTAGGTTTCATGAAGTTACTTTAAAACTTAG TGGAACATATTACCCAACATCACCTTTAGCTTTAGGTGAACTTTTACGAATTAGTGTTTTATTTAGTGAATATAAGGCGG ACCCAATCTTAGAAGTTCCTATCCATTCTATGGAAAAGAAATTTAAAAAATATCGGTGTAAGTTATCTTTGTTGTATGGC TTTGGTACTATTTTTTTATCATAGATTAAAATTAGACGGTTTAGAAAGTGGTTTAGAAAACTTAGGTGAATTTTTAGGCA TCAATTGTTTGGACCAATTTCCAACAATAAAGGAAAAAATGTTTTTGATCTACAATAAATATGAGAATAGGTTTAGAAGC ACAAACTCTGGAATATAGGAACCACAACAACAAGATGAAAACCCGCCTTCATTCTTGAATGTTTTCGGGTTGAAGAAGAA GAAGAAGACAACTCAAACAGAAGTTGGGAGTGGATCTTCATCGATAAGTGACAGAGGTGGCGGCGGCTTTAACGAGCTTA TGGCGTACCTCAGTGAGAGCTTAGTAGTCGACGGTACTTGAGAATTGTTTGAGTTAGTTCAATGGTGGAGGGCATGAGCA TTAACTTGGCCAATCTTAACTCGATTGGCAATGGATATATTTTCGATCCCAGTCTCCACTGTTTCATCCGGATAAGCCTT CAGTACGACAAGACGAATACATGAGGAATGCTGCAACGCATTGCAAAGGGACATTGTTAAAGCCTTGGTCTGCATTAAGG ATTGGGATCCTACCTATCAACGTATATAGGATAAAATTTCGCCGACAAGTCAAGAATGGATCGATGAATTTAATATATTA ACATTTAATTTTGAAGACGATCCTTCAGCTTCAAATTAAATTGTAAATTTGTAATTTGTAAATATGTATTTGCTTTTGCT ATTGTAATTG