>DTA_11_1_Mno length=4665;Class=DNA transposons;Order=TIR;superfamily=hAT; ACCTTTGCAGTCGACTAGTTATTGCTCAACAGTAAAAAATAGATTTGTTGTAAAGCGAGATTAAGAGATAGAAAACACTA TGAAAGGCCTATCTCCCTCACAACATTCGCAACTCTTCTACATCACTTTCAAGTCTCAACTCCTCTCACTCTCATAACTC TAGCTCTCATATTCTCTCTCTAATTCTTAGCTTTCTTTCTCGATTCTTAAATTTCTCTTATCTCTTTCATTTATAAATTC CAATCAAATTGAAGACATCCTAAAAAAAAGACATTCTACTCATTATTTTTGTATAATATTTTATTATTTAATGTTTGTTT ACATTGTTTATTATTAAAAATATTTTTGTTAACATTTTTTTTACAGATAATGGCAGAATCAACTACTTCTGATTTTGGAG ATCAACCATTTTATGATGATGAAATTTTGATGCACAACTCCAACCCTACTAATGAGGGTAATGTTTTGCTTGATGACCAA TCGGTGCACAACGAGGTTACAGGAGAGCGTGCAAGGGAAAAAAGACCGCGCACAGCTCCTGCATGGCAACATTACATAGA GGATCTACAACCAAATCCCAAAAAAGGTGAAATTAAAATGCATGCGGTTGTAAATATTGCAAAATAAAATATTTTTCTAA CAAAAAAGGTGGGGGTACAGGCCATCTCGATAGACATTGAAAAATATGTCTACCATTACACCAAAGTGGTGGTGTGGACT CCCACCAACAAACACTTTCACTCACAAATTAAGGTTTACAAAATTTTTCATATGATGCATAACGTGCTCGTGAGGCACTA GCTAAATTTTTAGGTAATGCCAAATTACCTTTGTCTTTTGCAGATGGTGAAGCATTTAAAGAATTGATTCAGACTGTATT TTGTCCACAATTTAAAAGGGTTAGTAGAAATATAACTAGAGCTGATTGCATAAAAGTTTTTATGCAATGAGACAATAGCT TGTTGATAATTTTAGGTCTTTTAATGCTACAGTCTCTTACACATTTGATCTTTAGGAAGATTGTAATAAAACTGGTTATT TATGTGTCACGACTCATTATATTGACAAGGATTGAGTTTTGCAAAAGCGAATTATTGGTTTTCGTTTATGTCATTTTCCA TATAATGCAAATGTTATTTTTTCTACTATTATGGAAATTTTTTTATGGCATTAAAAATAAAGTTTTAACCATTACTTTTG ATAATGCATCAGCAAACACAATTGCTATCAATATGTTCAAAGCAAATTTGAAACCAGCTTTTGGTGGAGAATTTTTTCAT CAACATTGTGCATGTCATATCATAAACTTAATAGTCTAAGCTGGTATTGAAATTATATCCCATCATCTAACTAAAATTAG AGATGTGTTATCTTTCATCTCAAGTTTTGGAACTCGACTCAAAGAATTTTGACAATATTGCAGGAATAGCCAGATGAGGT GAAATACCCCGGAGAATTAAATGAGATTAATTAAGATAATTGAGATTTATTAGTGTACCTAATTTGAATTAATTAATTAG TTATTAATTAATATATGTTTCTGACGTGTAAAGTTGAGTAATTCCAAGGTATTTAAATATTCTCAGTATTTATATTTTAA CCCAAAAGTGTGTATGGGCGCATTTTTAGACTGTTATTTTAAAATGTTGACATTTGTCCATTTTCTTTTCTTTTTCTTTT TCCTTTTCTTTCTTTTTCTCCTTTTCTCTTTCCTTTCCTGTACATACACACACACACACACACACTCTCTCTCTCTCTCT TCGTTCTCACTCTCTCGTTCCCTCACTCTCTCTCTCTTTCTCTCTCATGTTTTTGTCTCAAATCAACCAGATTTCGAACC AGAGAAGAATTTCAAGAAGTTTTCAACGTCAAGAGAAGGATTTGAGGTAAGATCTCTAAAAAATCTCTCTTGAATCTCGG ATTTGTGGATTTGAAAACTTATTTTTGGTTCGAAATAGATTTTGATAGATTTTGAGTAAACTAAGTTAGACATTGGAGAT CTTGGGTTCTTTAGACTTGTTTTAGGACCTAAAACTCGGATCTAGTGGTTGTCCTTTGAGATATTTTGATTTGGGACTGG ATTTGTAGGTTTTTGAACTGATTTCTGTGAGTTTTCTCGCACTGGTTTTCTTCACCGGTCGACCTGTGCGGTCAACCAGA TTGCATTGGCCTGACCGGTCGACCAGTAGGGTCGACCGGATTGCACACCACCGGTCGACCGGTGGTGTTGCACTGTTCTG TCACCAGTCGACCGGTGTGCACGGGGTTTGACCCTGTTTGGCCTGAAAATGCTGTTTTGACCCCTGTTTTTTAGGAGGAC CCAAATTAGCTTCATTTGGGGACCTAGAGTAGATGGATTAGCATCTTTAATCCCTGTTTTGAGATTGAAAACCCTTGGAA TGATGATTTGAAACATGAAATGGTTTGTGGAACCGGTAATTGAATTATGGCACACTAATAGGAAATCAAAAGGATATGAT TGAGTCTGAATTACTTTAGGAATGAGATTGGAATCCTAAAGTATTGTCTTGTAACAGTGCTAGCTGAGGACTCGGATTGA GTGGCTTGAGGAAGCGGAAGCCGGAATAGTACACTGCTAGCCACATGTTTGATAATTACGAGGTAGGATTTCTATCCCCT TTTCCTTGTGAGCCTGATTTTCAAAAAGAGTTTTAGCCTTGTAAATGTTTTAAAGAAAGGGGCTTGTTTGCGAAAGAAAA ATCTTTGAAAATCGTGGCTTGTTGTAGTTCACGGAATCCATGGCTTGTTGTAGTTCATGAAACCCATGGCTTGTTGTAGT TCATGAAACCCATGGCTTGTTGTAGTTCATGGGGCCCACGACTTGTGTAGTTCGTAGAATGATAATAACGATTTCATAAA ATTTAATGAATGATTTCTTAAGGTAAGAGATCTTGCGAACCGGTAAACTGGCTTATGGCCTAGATAGGATGTAGAGCGTG CATCCTCTGGGGCAGAACCTGAAACTCAGCCCGAGAAGGCTTGTGCATGTGGTTGTGTAAGTAATATGTATAAATTACTT GCTGATGCCTGTAATACGGTAATTTTCAGTTATATTTTCTTTGAGAAAAAGGATGTGAGGTTTTGGCTGTTGTGTTGAAA CTGAATGTCTCATTTATTTACTTATTCATTTATTTATTTACCGCTTTCTTATTTATCTACAAAGTTATTTCAAATTATAT CCTATTGGGCCTTTCGCTCACGTTTCTATTGTTTTATATATATTAAACCCCTTCTAGGCAAATCTAGGAGCGGTGCGGAG TAGCTGGATTGTTGCTACCGTTCGATCAAGTGAGGATTGTGTTCATCCTCTTGGATATATGTAAGGATTTGTAAATTTTA TAAACTCTGATATTTGGAATCCTAGACTTTGGTTGATGTCGGTAACTGTAATATTTTGTTTACATGTCATGTATGTACGT TAATGAGATCCTGTGGAAAGACCTTGTAGTTTATTTTAATTGAGTGTGGGGCTCGTTGGGAATTTTCTTTATTATCATGC GTTTAAACCCTAATCGAGCTCCACGTCACCGACCCCTGCTCCGGGGCGTGACATGAGGCCAAGAAAGTTTCGAACAGATG TTCAACATAGGTGGAACTCCACCTATTTAATGTTGAAAACTGCTATTCCGTATCAACATATAATCCTACATATGAGAACA CTAAGCATGGTGAGCATTTTATTTATGATGCAAATTGGAAGATTGGTGAATACTTTTTTAAATTTTTAGAAGTATTCTGC AATGCTACCGAATTACTTTCTAGTGTGTATTATCCCACTGTTCATCTTACTTCGCATCAATTATTTAATATTTATTTAAC ATTTGCTTATTATAGGCATAGTGATCTTTTTGCACCCATAGTAAGTGAAATGGAAAGAAAATTTAAAAGTTATTGCGCCA GTTGTCCAATTTCATATGCATTAGCAAAAATTTTAAATCCTATATGTCAATTAGATGGTGACGAATCTTTGAAGTCTGCT ACAGCAGATAATTTATCTGTTGATATGAAACTAACCATTGATGATGCAAGGAAAATGTTAGAAGATATATTTGCATTGTA TGAAAAAAATACGTAATAGGACAACAACAGTCAACTTCGACTTCAAAGAGCAGTGTTGGGCCTCAAGGTTCATCGTGGAG CTTCTAGAAGAGAAAAGAGAAAGCATTGGGATCATTATCAACACATGGACTATCTTCAGAACTTGTCAAATATTTTGAGT CAAAGTTTGTAATTGATAATGACAAACTAGACATCTTACAGCGGTGAAAGAGCAAGCAAGATCATTTTCCCACAATATTC ATTATAGCATGTGACATTTTGACAACTCCAGTGTCCACAGTAGCATCAGAGCAAGCATTTATTGCAAGCAATCGAATTCT TGAAGATAAGAGGAGCAGAATGTACCCGGATATTTTGGAGGGGCTAAAGTGCGTGAAAGACTGAGAAGATGCAATAAGAC AAAAACAACATTATACAAATGATACACTTCTAGACAATTTTTCAAACTAGGACATAGCAGAATCTTCAGGAAGCAATTCG GCCATAGTGTAATTTAATTATCCTTGAATATTTCACTCTTTTTTCCTTCATAAAGGTTTTGTCCTGATCTCCTCACAGGT TTTACTTGGCAAGGTTTTTAACGAG