>DTA_10_1_Mno length=2432;Class=DNA transposons;Order=TIR;superfamily=hAT; TTGTAGCTAACAACCCTAGTTTTGAGTATTTAAGTTTTAGAACGTTGCAACAGTGCATGCAACAAATAAACGAATTTTAA ACATGACGATTTAAATGATTGATTTTAAAAGGACTTTAAGATGTACTTGAATTTAAGATTTCTCACGAAATCCGTTTTAA AGTCAAATTAAATGGCCCAATTGAATTGGCTAGTTTTAGAAAGGCTTTTAAAGAGTATTTGAAACAAGAGTTCAAACACA GCTCCATTTGAAAAATATTTCTAGAAGGTTTTATCTTAATTGAAATTAAGAAAAGCTTTAAGAAATTCAGTGATTTATTC TTTTGAAATTATTGTTATGAATTATGAAAGTATTCATTCTTATGTTTAAAAGAAAAAAAAATGTTCCGCAAATTTTAAGA AATGCCAGTAAGTACAAGTTAAAGTTTAAGTTACAGTGGCGACCTCATAGGAGGGTCGTCACACCCACTAAACCAGAAAA TGCTCCAGTTGATAATGCTTCAGTGCACAACGAGGAAGTTAGAAAACGCAGCAAGGGAAAAAGACTGTGAACTTCTCCTG CATGGCAGCATTTCACAGAGTAGCCCCGAACAAATATAAAAACAGGTGAAATAGAAATTCATGCGATATGTAAGTATTGT AAAAAATACTTTTTAAATAAAAAAGGTGGGTGTACTGGTCATCTGGATAGATATTGGAAAGTATGACTACCGTTGCATCA AGGTGGGAGTGTAGACTCCTGCCATCACACACTATCACTCACATCACAGGGGTTGCAAAATTTTACATACGATGCACAAT GTGCTCGTGAGGCACTAACTAAATTTTTAGCTAGTGCCGAATTGTCTCTTTCTTTTGCAGATGATGCGTCGTTCTAAGAA TTCATATAGATGATATTCTGCCCACAATTTAAATGGGTAAGTAGAAACACGACTCATTTTGATTGCATGAAAGTGTTTTA TGCAATGAGACAATCTCTTGTTGATAATTTTAGGACTTTTAATGCTATTGTATCTTGTACTTCTAATCTATGGGAGGGGT GCAATAAAACTAGATATTTATGCGTCACGGCACATTATATTGATGACGAATGAGTTTTACAAAAAAGAATAATAGGTTTT CATTTATGTCCATATCATCATTACGCATCATCTATTTTTAGTACAATAATGAAAATTTTTGGGTTTGATGGGATAAAAGA AAAAGTTCAGGTAGGAATTGAACATATTTTAGCTAATCTAACAAATATTAGAGAATCTTTATCCTTTATATCTAGTTCTG GAGCTCGGCTCTAAGAATTCAAACAATATTGCAGGAACAGCCAGATGCGCCCAAGAAAGTTCCCCACTGACGTGAGACAT ATGTGGAATTCCACCTATTTAATGTTGAATGTTGTACTCCCGTATTCGGAGCTCATCACTGCGTATGTAAACAGTAAGAA CGATCAACTTCTAATTTTAGATACAGATTGGCAGATTTGTGAGTATTTTTTAAAATTTTTAGAAGTTTTTTACAATGCTA CTGAATTACTTTTTGGAGTTTATTATCCTACTGTACATTTAGCTTTACATCAACTATTTAATATTTCAGAAACATTTTCT TATTATAGGGATACAAAACTTTTTGGAGACATAGTTAAGTTAATGGAACTAAATTTAAAAGTTATTGGTCAGGTTGTCCT ATGTTATATGCATTAGCAATTATTTTAGATCCTAGGTGTGGAGTAGATGGAACTGAATCATTAATGATTGCTACAACAGA AAATTTAGGAATTGATATGCAACTAACTATTACTAACGCTAAGAAAATGTTAGAAAATGTATTTAGTTTGTATGAAGTAA AATACAACACAAGTAAAAAAGAATAGGGAACTTCGACGTCAACTAGCTGTTCGGGCCCCAAAGGATCATCGTGGAGTTTC TTGAAGAAGAAAGAGAAAACGGCAAGATCGTCATCAACATAAGTGTCTACCGAACTAGTAAAATATTTTGAAGCAAATTT TGTAATCGATGACGACAAACTAGACATCTTACAGTTGTGGAAGAGCAAGATCGATCGTTTTCCAACACTGTTCGTAATAG CTCATGACATTCTTACAACTCCAGTGTCAACGGTAGCATCGACAAGCATTTAGTGTAAGCAACCAAATTCTTGACGAGAA GAGAAGCAGAATGCATCCATATATCTTGGAGGGGCTAATGTGCTTTTTAGACTGGGAAGATGCCAGAAGACGAAGACAAC AAAACACGTATGATTCAATGCAAGACTATTTTTCTAACCTAGAAATAACAGAATCTTCTGAAAGTACTTAGGTTTGTAAT TTACTATTCCTATTGCACTTTTTTTCCTTCACAAAGGTTTTGTCCCGATCTCCCCACGGATTTTACTTGGCAAAGTTTTT AACGAGCCAGTCATTTATGTGTACTTATTCGT