>DTA_1N_1_Mno length=640;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGCTGTTCATAAACCCGCAAAACCCGCAGGCCCAACCCACCTCACCCCAACCCAACCCGAAAAATGTAATTTTTAGT ATTAAATTTTTTTTTCGGCCCATTCAATGTCTGGCCCGAAGTTTTGGGGCGGGGTGTGGGTTGGGCCTATAATGGCCCGC ACACCCCAACCCAACCCGCGCTCTAACTTGCCTCCTCTAATATCTAACCCTAGGCAGGCAACTCATTTCTACTCTCTAGT TTCTTCATGTTTGAATTAAGCCTCTATGTTTGCTTTATGTTAAGACTAATTTATGAGTGTAGACTAATTTATGTTTGCTT TATGTTTGATGTTGGATGGACTACTTTGCTTCATGTTTGATGTTGGATTGAACTTTGAATTTCTATCTGTTTGAATGTTG GAGTTATTATTTCTATTTGATGATGAACTTTGAATGTTGGATTGAACTTTGAGTCTTTGATTCTTTGAATGTTGAAACCG ACCACCCAACCCACCCCGCACCGCCCCAACCCAACCCAAACATCATTGGGTTGTGAAATTTTTCTAACATCGTTGGGGCC AAATATGTGCAACCCGCACCCTTTGGGGCGGGAGAAGAAAAAGTCCTACCCCGCACCAACCCAACCCATGAACAGCCCTA >DTA_1N_2_Mno length=706;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGCTGTTCATGGGTTGGGTTGGTGCGGGGTAGGATTTTTTTTCCCCGCCCCATAGGGTGCGGGTTACACATATTTAG CCCCAACGATGTTAGAATTTTTTCACAACCCAACGATGTTCGGGTTGGGTTGGGGCGGTGCGGGGTGGGTTGGGTGGTCG GTTTCAACATTCAAAAAATTAAAGACTTAAAGTTCAATCTAACATTCAAAGTTCATAATCAAATAGAAATAGCAACCATT CTTATGAGTCCATCTAACATCAAACATGTAGCAAAGCAGTCCATCCAACATCAAATATAAAGCAAACATAAATTAGTCTA CACTCATAAATTAGTCTTAACATAAAGCAAACATAGATGCTTAATTCAAATCCATCTAAAGCAAGCATTGCAACAGCAAC AATCCTTATCAGTCCACACCCATAGGCTCCTCAATGGTTGTAGTAGGACATGAAGTTGAGTTATCTACAAGAGAAATGAA AATAGCTTAAGTAATAATTTGGATAGTTAGTTTAGACATGTGTTGTGCGGGTTGGGTTGGGGTTGCGGGTTGTTATGGGC CCAACCCACAACCCGCCCCAAACACTTCGGGCCAGAGGTATAATGGGCCGAAAATTAAAAAATAATGCTGCGGGTTACTT TTTTCGGGTTGGGTTGGGGCGGTGCGGGGTGGGTTTGCGGGTTGTTCGGGTTTATGAACACCCCTA >DTA_1N_3_Mno length=826;Class=DNA transposons;Order=MITE;superfamily=MITE; GGGCTGTTCATAAACCCGAACAACCCGCAAACCCAACCCACCCCGCCCCAACCCAAGCCGAAAAAAGCAACCCGCAGCAT TATTTTTAAATTTTCGGCCCATTATACCTCTGGCCCGAAGTGTTTGGGGCGGATTGCGGGTTGGGCCCATAACAACCCGC AATCCCCAACCCAACCCGCACAACATACCTCCAAGCTTTCGGCCTAAGCCCAACCTGCCCAAGTTCTACCCTGGCTCCTG ACATTAGGTAAGACAATAATTTGTATGTATCTTAATCTATTTTATTATATGAACTCTAAACTATCCAAATTATTACTTAA GCTATTTTCATTTCTCTTGTAGATAACTCAACTTCATGTCCTACTACAACCATTGAGGAGCCTATGAGTGTGGATTGATA AAGATGGTTGATGTTGCAATGCTTGCTTTGGATGGATTTGAATTAAGATTTAAGCATCTATGTTTGCTTTGTTAAGCATT TTTTTATGTTAAGACTAATTTATAAGTGTAGACTAATTTATGTTTGCTTTGTATTTGATGTTGGATGGACTATTTTGCTT CATGTTTGATGTTAGATGGACTCATAAAGATGGTTGCTATTTCTATTTAATGATGAAATTTGAATATTATATTGAACTTT AAGTCTTTAATTTTTTGAATGTTGAAACCGACCACCCAACCCACCCCGCACCGCCCCAACCCAACCCGAACATCGTTGGG TTGTGAAATTTTTCTAACATCGTTGGGGCTAAATATGTGCAACCCGCACCCTTTGGGGCGGGAAAAAAAAATCCTACCCC GCACCAACCCAACCCATGAACAGCCC >DTA_1N_4_Mno length=670;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGCTGTTCATGGGTTGGGTTGGTGCGGGGTAGGACTTTTTTTTCCCCGCCCCAAAGGGTGCGGGTTGCACATATTTG GCCCCAACGATGTTAGAAAAATTTCACAACCCAACGATGTTCGGGTTGGGTTGGGGCGGTGCGGGGTGGGTTGGGTGGTC GGTTTCAACATTCAAAAAATCAAAGACTTAAAGTTCAATATAATATTCAAACTTCATCATTAAATAGAAATAGCAACCAT CCTTATCAGTCCGGCGAGAGAGCACCGGAGAAAGTGGGCAAGACGGCGGCCGAGAGGACTGAGCAATGAGGAGAGAGTTA TGAGGGGGTTCACGGGAGGGGAAGAAGAGGGAAAACTGAAAAGGAAGAGGCAAGAAGAGGGGGTTCACGGGAGGGGAGAC CGAGAATGAGATTGTGAACCCTAATGTTAGCGAGCCTAGGGTAGAACTTGGGCAGTTCGGCTTGGGCCGAAAGCTTGGGG GTATGTTGTGCGGGTTGGGTTGGGGATTGCGGGTTGTTATGGGCCCAACCCGCAATCCGCCCCAAACACTTCGGGCCAGA GGTATAATGAGCCGCAAATTTAAAAATAATGCTGCGGGTTGCTTTTTTCGGCTTGGGTTGGGGCGGGGTGGGTTGGGTTT GCGGGTTGTTCGGGTTTATGAACAGCCCTA >DTA_1N_5_Mno length=597;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGCTGTACATGGGTTGGGTTGGTGCGGGGTAGGATTTTTTCTTGTCCCGCCCCAAAGGGTGCGGGTTGCACATATTT GGCCCCAACGATGTTAAAAAAATTTCACAACCCAATGATGTTTGGGTTGGGTTGGGGCGGGGCGGGGTGGGTTAGGTGGT CGGGCTCATCATTCAAAGAATCAAAGTTCAATCCAGAGGCGGAGAGAGCCAAGAGGAGAGGCGGAGAGGCAGAGAGCGAG AGGAGAGGCGGAAAGAAGCCGCCGGCGCTGGAGAGCTTAAGGATCTAGGTCGACTGGTCGAGGAAGGACTGAAGACAGTC TGTGTCTGCGTGTGGAGAGGAGAGTTGCTAGACGAGAGAGAGTAGAGCCTAGGGTTAGAACTTAGAACTTAGAGGACATG GCCCATGCATGTTTGTGCGGGTTGGGTTGGGGTATGCAGGTTATTATAGGCCCAACCCACAAACCGCCCCAAACACCTCG GGCCAGACATTTAGTGGGCCAAAAAATAAAAAATAATGTTACAAGTTGCCTTTTTCGGGTTGGGTTGGGGTGAGGTGAGT TGGGTTTGCGAGTTGTTCGGGTTTATGTACAACCCTA