>DHH_9_1_Mno length=14734;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTTATTATATAAAAATATTACAATATCTATTTACTTATTTACTGTTCCCTCCACTGAATCAGTTACTCATCCATATTTT GCGCAAATTCCTGTTATTTAATTATGCTAATCTTTTTATTCTCATATCCTTTACCTTCAAATATTACAAGATAATATGTT TTATTTATATAGTTGCTCTTGCTTTGTAACCATACTTAGTATGCTCTTGCTTATTTATTTTATTAATCTTAGCCACTGAT GTTACTAATCATTTATTTATTTATCCATTTATGCTTTCCCAGATTGTTCTCCTTTTTCTATGTTGTTTCTAAATTTTGTA CAGCTACATTTCATCTTAAGATCTATATCATTCCTTTGTTTATTTATAGAAGACGCTGAAAATATGTAAATCGATAAATC AATTTATTCACTTATGTATTCTTTGTTTATTAAGTGAATGTATTCACTATTATTATTGTATTTGTTGACGGAGTTTTTCT GACAACGCGTGATTTACTCTCCCAAGACACTCTCAATAACACTCACGGTTTAAATAAGGATTAATGTTGAGAAATAATGT AAACGAGACAGAGATTTATAGTGGTACGGCAAGAATTCTTTGCCTAATCCACTTGTGGATACACTAATATCTTCTGAGAT TACAAACTCTCTTGGAGTAATGAAATAGTGCGTAACCCCCCTCATGGATCTTCTTGGCTTTACTTATAGGCCTTTACATG CGATTATCCCTTCTCCGTTCCCAAGGAGGAAGCCACCTTCCCCGTTCTCAAGGAGGAAGCCATCTTCTATTCCTCGATTT ACGAGTGGGGTAGGTACGTTTTCATGATGGCAGCCTCAGGAAATATGGCTGATCCTCCTCATCTGCCGTCTGATTTTCTG ACTCCCGCAGCTGCAGTTGGAACAGTACTTCCTTCCCCGAGTTGACAAGACCGTTAATGGATTTGACTGGACGTGCTCCC TCGACGTAATGGCCTCACAAGTCAAGTCATGGCACTCGCCACGTATGGTCTCTCGACAAAAAGGGCAGTTTAGCTACAGC TGTTCCCCCGACGCCAACGACTGATTCTCAATGGGGAGTCCTCGGTGCCCATCGTTCGAGAGAGTGGTCGATCCTCGACC ATGGTGTAACAATTACCCCCTAGACTGGGATGCCGCATTGTGACTTTTCTGGCTACACGGCGTCGAGAGCGCCACATCAG AGAGGCTTTTCTGCAGGTAAGGGTGGCCGCGTGTTGGTACAGTGCATCATTGCGGTTGGTTCCCCGGGTAGTGGAGCGGT CACATCGATCGCGTCAACAGTCACGTCTCTACTTCCCTGAAGCCGTGTGGCATTGGGAGGATGAATCGCTGCCGTCCGAT TAAGTCCTTCTCCCGTTGCTTTCTCCCCATCAGTTCGATCGTGCATTCTCAGATCCACCATCAGATGGACCGAATCGGAT TCTACGATCGAGATTTGGAGTCCTTTGGACTCCTCGGGGACCCTTGGGCTCCTTCTCTGGCGCATATATATGCCCTTATA TCCGCAGCTATCTGGTCACCAAGCCTTCAGGACGCCGCTACTCTGCCAGATTTTCGTCAGAAACTTTCGTCTCCGTGCAT TCTTCCACGCATTGCTCGTTTTTGCCTTCAGACTCAGGCCTTCTTCGAATCTGGTAAGCCCTCATTTCCTTTGTTCTTCT TGTGAGTCTAGTTCTAGTGTCTGCAAAACCAGGCCCAAATGCGTTATGAGGAAGGGAGATGTACTTACCTAGCGGTGCCG GCCGTGAGCCAGGGGCTAAGCCCGCACGGCCTGATCCGTTTGGGCGCAGTTGTTTTGGCCTGAGACCTTCGAGCTCGGCT TTGGGTCTCTTTGACTTATGGCATAAATTTGTCTTTCTTTTGTATGGCTACAAAGCCCGAGTGTTGTATCCTTGACTCGG GGACCTCTGGTCTGAACACTCGTCACTCCCCTTCGCACTGTACTTTTGACCTCTCGACCACTAGGATCTAACCAAACCCC TTTTGCTTATTTTCAGAACATGTTACCAGAACAGGTTAGGGGTCGAGAGGTCTCCACCTCCAGGGTAAGGGACGACTCTA AAGAGATGACCACATCCAGCTCATCCTCGGGTGAAAGCGGGGATTCGTTGCTCCGCCAAGTCGAGGACTACACCGAGGCT TCGGCCTCTGCCTCCCGGTCGGATGAGCTAATACTTCTCGATGATGAGGATGTTAGCCTACAGGTCGGCCCTTCCGAAGG CCGCAGCCATGGGGTGGCATCGACCAGCGGACTTACGGGGATGGTCACGGATGTTAATCCGTCAAAGATTAGACCCCAAG CCACGATGAAGGCCTTCAATGATGCAGGGATCGACCCCCTGCATTTTTACTTGATTATCCTGACTCCTAATGATCGGGCT AACGCGCCCCCACCCCGCCATATAACTGTATATATGCACTCATTGAGCTTTGGGCAAACTCTGCCTTTTCATCCTCTCAT GAAGGCCCTTTGCAGCCTTAATAGGATTTTTCCGGCATAGTTGTCTCCCAACTGCTGGATGACCATTAACTCCATGATAA TTTTGTGGAGAAAATATTTGAACCTCGACCTAACCGTTGAGGAGTTTTTGTACTGTTACGCCCTCAAGGCCTCCCCGAAC CAAAGGGGGTTTTTCTACTTGGCTGCCCACGCCAAGGCCAAGCTGCCCGTGCCCCTTCTGGTGGTCGAGAAGACCTCCAG TTCGCACAGGTGGAAGCCCCAATTTTTCTTCGTTAGGGGCAATTCAATTCCCACCCTCTCAACGGTGAGCGTCGGATAGG GACGCAGATAGTATTAAGTCAATACTGTAGGTTATTCATTTCCGCTAACCTGATAACGTTTGTTCTGCCTGTTAAATCTT TTTTAAATTGTTGCTTCTTACTGTAGGTGACGTCGTCCCTCGACCCCGACTCTCTGCTTCCGCCCTTGCGCACATCGAGG AGATTCTTGCTCATCCCGAAGACCACCGTTGTGCCTCGGTTCTCAATACTGTTGAGAACCGTCGACTGTATGGCTTGTCT GTGCTTTTTGACACCCCGCGCTCCTCAGTTGTTCCTCCTACTGATCTTCTTGGTGGTGAGTTAGGTTTTTCTCGCCTTCA TCTTTTAAGCAAGAGCCAGGGAAAATGGGTGAGTAATCCTTGATTTGGCCTTTCTTTTCTTGTAGCCGTGCCATCTGAAA TGAGGTACGCCATCCCGGGCAAGCAGAAGAAGAAGAGGGGGCGAGATCCCACCCCTACGCCACTGAGCCAGCCACGCGTC TAGGTCTCCCCATCCCCTGGCGTCATTGAGACTCCAGTTCAGGGGATGTTTATGGTCGAGCCCACTGTCAAGAGGGCAAG GGTCGAGGTGCCCCAGGCTCATGCCACCGTCGAGGGAACCTCGTCTCAGCCTTCCCGACGCTCAGATAAGGTGAAAAGCG TCGCGGCGTCTGTACTGGGGGATCCCTTGGTGATGCCGGGGTCAAAGATTAATGACCCTGACTTCTCCGCTGCGGACGTG GTCTCTCAGTACCTCGACGCTGCTTTACGGCTTCCTCCCCGCTTCAGCCTTCCGCTCCAGGCCATATATACATACTTCCA CCCGGATTCCTGGGGCTTCTATGCCGGGAAGAGCATCCTGGAGCGTCAACGCTTAACCATGATGCACTTGGTCTCGGTAA GCTTGACTTGTTATCACTCGACATTTACCAGTCGAGTGCCCAGTTTTAATGCCTTGGGACTTATTTTCCTCCTTGTGTGC TTCAGGCTCTTGAGATTGTACTCCAGAACTACGTGGAGCTGGAATTCCTGCTTGAACAGAACACGGCATCGAGAACTTCA GCTGAGGAGGTTAAGGCCTTGCGCACTGCTCGGGATGAGCTTTCCTTCAGCCTGGACGTCGAGAAGGCCAAGGTCCAGTC CCTGGAAGAGATTATGGAGAAGGAGAAGGAGAAGAGCTTCCAGGCGGGGTGTTCCTCGGTAGTCCAATAATACCTTGCAT CTCCCATCTTCGAGCAGAAGAAGAGGGAGGTGCTAGAGGAGTTCCTGAGGTCCGAGACGTATAACCACTCTGTCGATGCC CGCCTGGAGGCCTTCAAGTCATCCCCAGAATTCCAGCGTTTGGTCGACGCCCAGGTGGAGCAATTCAAGGCTTCAGGGGC TTTCGAGGGTCTCGTTACTCAATGACTTGGGCTTACAAGGCCTCCCTTGAGTTTGATGAGCTCTAATTGTCCTTGATGAC ATCCGCTGGTGACCAGATTCTCAACCGCTTCCGAAGAAATTGCCTAGATGTCGACCTGTCCTTCCTCGACGAGCCTGACA GCGAGGAGGTAGAGGTGGTCGAGCTCGACCCGGAGGCTGGGAGCACCAATCAGATACAGGCAGATGCTGGGCAAGCACCC GGAGATGTTGAGCAGGTACCAGGAGATGACGGCGAGTCGGTGCTGGGAGGAGGGGGCGAGAAGGCGTCGGGGGATGGGGC TGAGTAGTGAAGGGACCCTCTGCTTTTCTCATGTTTTCTTTTTGAAAGGCCATGAGACCAAGACATTATTTGCTGGTCTG TAATGACCATAAAGTCGAGACAAGTATTTTTATTTCTTTTTATATATATTCATGCTTGTTTTTCTAATTGTGTGTGTAGG TGCTATGGATATTACGCATGTGGAGAATTTTTCGCTAAGTGTGGTTGAGCTCTAGCTCAACCACCTTTGTAAGTTTTTTT TTTTTTTTTTGTGGGGCGCCTCATTGTTGGCCTTATTCCCCCCTCGTCAAAAACAAAGTCTTGGACTTGTTTTTGACGCA CCGTGGTCGACGTATCGACAGCGTTTAGTCAACGTATCGACATTTTGGTCGATGTATCGACATTTTTTAGGTCGATATAT CGACATTTTGGTCGACGTATCAACGTTTTTAGGTCGACGTATTGACATCTTTAGTTGGTTGACGTATCGACGTTGACAGT AGATGAGTGAGCCCATATGAGAATCAGTCGAGACGCAAAACAAAGTTGGCTAAGTAGACAATGCAATTTACCTCTATTTA TGTAGGATTTACAAGTCGATGCTCTTCACAAGAATAGAGAACATGCAAAAGGTACTTAACTTAGCCTTTTTGGTCGACGT ACCTCGCAATCATTGGTAGTAGACCTTCAGCTAGTCTGCATTCCAAGTGTGCTTAAGGTCTCGACCATTAGGCTTTGCCA GTCGATACGACCCGTTGGCCACAACTTCCTTTATTTTGTAGGGTCCTTCCCAAGTCGGCCCCAAGGCACCAGAGTTCTTC GGCTTGGTATTTGGGGTTACCACCCACAGGACTAGATCTCCAACCTTGAAGCGCTTCTGCTTGACTTTTGTGTTGTAGTA CCTAGCAATTCTGACTTGGTACGCGGCGAGCCTTAGCTGCGCATCTGTGCATCTTTCTTCCAGAAGGTCGAGTTCCAGGT TCATCAGTTCGGCGTTCCTGCCTTCCTCGTATCGAGCTACTCGGCAAGTCAGAATAGAGACCTCGACATGGAGGACTGCT TCAGCTCTGTAGGCCATTGAGAAGGGGGTTTCCCCTGTAGTGGTCCTACTCGTGGTTCTGTAGGCCCACAGGACTTTCGG CAGCTCGTCTGTCCATTTTCCTTTATAGGCGTCGAGCCTTCGCTTAAGCGTTACCTTTATGATTTTGTTGACCGCCTCGA CCTGCCCGTTAGACTGTGGGTATACAACAGAGGAGAAGTTCTTATGAATTCCCAATAGTTCACAAAATTGGTTGGTGTTG TCGTTGTTGAATTGTCTCCCGTTGTCAGACACGAGAGAATGCGGTACACCAAACATGCAAACTATGTTGTTCCATATGAA GTTAGTGCATTTCTCCTCTGAGATAGTTGATAGTGGCTCGGTCTCTACCCACTTGGTAAAGTAGTCGACGGCCACGATAG CGAACTTGTATCCCCCCGGGGTTTTATGTAGTGGATCAATTAAGTCGATCCCCCACTTGGCAAAAGGCCAGGGGGAGACT ATTGACGTTAAATCCTCTCAATGCAGTCGAGGAATGGGGGCATACCTTTGGCAGTTTTCACACCTTTTCGCATAGTCGGC CGCATCCTTTTTTAGGCTAGGCCAATAGTACCCCTGCTGTAGTATTTTGTAGGCTAAGGATTGCCCTCTTGCGTGGTTTC TGCATGTACCATCATGCACTTTCGAGAGCGCCCTCCTCACCTCTTCTTCTCTGAGGCACCTGAGCAATGGCGTCGAGTAC CCCCTTCGATAGAGAACATTGTCATGCAACGTATATCTCGACACCTGATACCTCAACCTTTTTGCCTGCTGTCTGTCTTC AGGGAGTTCACCGTCGACCAAATACCTGATGATTGGAGCCATGGTTGCTGTTTCTCATAAGATTTGATTTCTGGGTTCAG CTGCCCTTTTTCTAGCGCCAATTGTTGACGGTGTTTTTCCGACAACGCGTGATTTACTCTCCCAAGACACTCTCAGTAAC ACTCATGCTTTAAATAAGGATTAATGTTGAGAAATAATGTAAACGAGACAGAGATTTATAGTGGTTCGGTAAGAATTCTT TGCCTAATCCACTTGTGGATGCACTAATATCTTTTGAGATTACAAACTCTCTTGGAGTAATGAAATAGTACGTAACCCCC CTCATGGATCTTCTTCGCTCTATTTATAGGCCTTTACATGCGATTATCCCTTCTCCGTTCCCAAGGAGGAAGCCACTTTC CCCGTTCCCAAGGAGGAAGCCATCTTCTATTCCTCGATTTACGGGCGGGGTAGGTGCGTTTTCATGATGGCAACCTCAAG AAATGCGGCTGATCCCTCTCATTTGCCGCCCGATTTCCTGACTCCCGCAGCAGCAGTTGGAACAGTACTTCCTTCCCCGA GTTGACAAGACTATTGATGGATTTGATTGGACGTGTTGCGTCGACGTAATGGCCTCCACAAGTTGAGTCATGGTGCTCGC CACTTATGGTCTCTCAACGTAAAGGGCACTTTAGCTACAGCTGTTCCCCCGACGCCAGCGACCGATTCTCAACAGGAAGT CCTCAGCGCTCGTCATTCGAGAGAGTGGTCGATCCTCGACCATGATGTAACAGTATTCATTTAGTTTGTATGTAATTACG TATGGCCCTGTAAATCTCAAACTTTTTTCCTTATACATGATCTCATGCTATTTCCTTTATCCGAATATATAAAAGCATCA ATATATAGAGACATAAGTACAAAATCATTTTTTAATGTATTTTTAATATTACTGAATAACTTAATCCTAGAATAAACTAC AGCTATAATTCAATTTTAGAACAAGTTATAAATATAGTTACATAACTTAATAAATCTGTTTTTATACAAACATTGCCCTT AATATTTCTAACCATTTTTAACGAAGTATACTTGATAAATACATCAATTAATCAAATTCTTTTTCCCCTTTAGAGCCCAA ATACTTTGACACTGCGAGAGCACATGGATAGGAGAAAAATTCAAAAGAAATCAAGAAGACCAAATCAATACATACATCGC CCCATTTTGCTAACAAATGCAGACTTCATTAATACACATGATGGCCGCCGAAATCAAACAAACCAAATTCTCGAATCTGC ATCAACAAGACCATCTCGGTCTATACTTGATATGATGCCCACACATCTTCAATTTGAAGGAGAAATTCCTGAGTCATCTT CTTTCTCAAGATTTGAAAATTATAGTCAAGATCGTAATTTTCCCACCTCTATTAATTCCTATAATCCAATAATTATAAAA TATTTGTATGGGAACAACACTAATCTCCTGTCTATTATTTTGATGACTTCCTTTTTCCCACCATTTTAGGCACTGCCAAT TCATATATTGACCTTGGAGACTGCTCTTGCACCTGTGACCACTGTGGTGCTTTGTTTTGCTTCGCGGAACGAATCAAAGG CAATAGACAAATTAAATATAATCTTTGTTGTAGAAATGGAAAAATAACTTTACCCCTTATTAAACAAACTCCTCCTATAT TAGATAAATTACTTAATTATCATGGAGGATTAATCAATACACACTTCTAAAAAAATCTTTGAACATATAACTCCATGTTT CCCTTCACATCATTTGGAGTTAATATAGAAACCAATACAAGAAACTCAAATGGCCCATATATTTTTAAAATAAGTGGACA AATCCATCATCTCATAGGATCTTTATTACCAATCGAAAATAACCGTCCAAGATTTACACAACTCTATGTCTATGACACAC AAAATGAAATTGAAAATCTAATAGCAACATCATTTTCAAATAATGACCAAGATAAAACTTTAATCCAATTTATAACTGAA ATTATAATCAAAATGCTTGATAATACAAACAAATTAGTCAAACTTTTTCAGACGATAAGAGATAGATATCAACAAGATGA AATACCATGTATGAAACTAAGACTTATAGGCTGAAGAAACACAGATAGCAACCAGTATGAATTACCCACTTCAAACAATA TTGGTGGCCTAATAGTTAGAGACATTGGTGAATACGAACAAGGAAGAGACATTATAATCCAGGATAGAACAAATATTTTA CAAAGAATTACAAAATTACTTCCATCTTACATGGCTCTCCAATATCCTTTATTATTTTCTTATGGGGAATACAACAGATT TAAATTATAATATAGCCAATACAACGAACAAATCCACAAGAAAAAATGACAAAATGCAAGGCAACACTCTTTTTCGAGCT GGTAGATTATTTCAGCAATATGTAGTTGATGTATATGCCTTCGTAGAAGAAGATCGTTTAGACTATATCAGAAAAATTAA AAAAATTTATGATCTGAAATTTACCAAGGAATTCAAGATGCTATTACTAGAGGAGATACCAATGCACAAGCAGTAGGAAA AAGAATTATTCTTCACTCCAGCCATATAGGAAGCCCTAGATATATGAATCAAAATTATCAAGATGCATTGGCAATTTGTA GACATTATGGAAACCTAAATTTATTCATAACATTCACATGCAATCCAAAATGACCTGAGATTACTAGAGCTCTAACAAAA ATATTAGGACAAAAACCTAAAGATAGACCAGATATTATTACAAGAATCTTTAAAATGAAATTAGAACATATTTTATTCGT CATCAAAGATGAAAAAAATATTTGGAACAATTATAGCAGGTTAGCTTACCCCCTTAAAGTTCATTTTTTTTTTTAATTTT TTAGATTTCTATGTTGTAGAATTCTGAAAACGAGGTCTGCCACATTCGCATTTCCTTTTTTAGCTGCATCACAACGAAAA ACTACGCGAACCATCACAGATAGACAGATTCATTTATGCAGAAATACCTGACCCTAACCACAATCCATTATAATATAATA TTGTAGTTGAATTTATGTTGCATGTACCATGTGGACTAGCCAAAACAAATTCCCCATGTATGAAAAATTCAGAATGTTTA AAAAAATTTCCAAAAGAATTAAGAAGTGAAACAACAATCGAAGAAAATGGATTTGTCAATTATAGACGCAGAAATACACC CTTTCGCATACAAAAAGAAAATATTAACTTAGATAATAGATTTGTAGTTCCTTACAATAAAGATCTATGTTTAAAATTTC ATGCCCATACCAATATAGAAGTTTGTTCACAATCTATGCTTATAAAATATTTATTGAAATACCTAACAAAAGGGCTAGAC AGAATAAGAGCAGTCATAGAGGATAATATATGTACAGAAAATATAGGACAAACTACATACCAACAAATAGATGAGATAAA AAATTATATTAACTGTATATATATAACACCATACGAAGTAATGTAGCGACTATATGAATTCCCAATACATCACAGAAACC CAGCTGTGCAAAGACTTTCAATACATTTACTAAAAATGTAAAATATAACATTTCGCTCAAATGAACACCCAAATAATATA ATAAGGCAGTCATGTATTGATAAAACAACTCTAACTGAATGGATGGAAACAAATAAACGTTATCTCAATGCTAGACAGCT AACTTATACAAAATTCCCAACTAAATATGTTTGGAATAACAAATATAAATATTGGTCCCCCAGACAGACATGAAATACAA TCGGCCAAACTTTCCATGTCCATCCATGCTCCGGAGAATTATACTATCTAAAATTATTACTAAACTATCAAAGAGGAAAA ACAAGTTATGAAGCTCTTCGAACAATTAATAATACAACATACTCAACAAACCAAGCATCATGTTACATACTAGGCTTACT TGGAGATGACAAGGAATGAAATGAATCCATACTAGAAGCCTCCTTTTGGTCAACAGCATCCCAATTACGACAGCTATTCA TTACTATTCTACTATTTTGCAACGTAAATAATCTAAAAGAATTACTTGACACACATTGGAAACTTATGACAGATGATATC TTATACAAAATCGAAGTCCTATTTGATAACCAAAATTTTCAAATACCTGAAATCGAACTATATATAATTTTGTATTATAT GAACTAGAAAAATTTTTAAACATAAATTCATCAAGTTTAACACATTTTAAGAGAAGAACTTAATCATGACATAAACAAAT TAAAAGAACAAAACATAAAATTAGTACAAAACTTAAAATAATGAACAACAACTTATTTACCAAAAAATCCTACAATCATT ACATCGTGAAAGCAATAATCTCTTTTTCATCCATGGTCACGGCGGAACTGGAAAAACATATCTTTGGAATGCAATAATCA CAAAAGCCGGATCAAAAAATGAAATAATTCTTTCTGTGACATCTTCTGGAATTGCATCATTATTACTACCCAAAGGAAGA ACTGTGCATTCTAGATTTTGAATACCATTATCAATAGATAAATTTTCTACATGTCACATTAAAAAGGGAACTCAATTAGC AAAATTAATAGGAAACACATCACTCATATTATGAGATGAAGCACCCATGACTAATAAATATTATTTTGAAGCACTAGACA AAACACTCCAAGATTTAAAAAATAATTATGAACAACCATTTGGTGGAATGACAATTGTCTTAGGAGGTGATTTCTGACAA ATTTCACCAGTAATCCCCACGGGAACAAAAGAACATATAATAGATGCAACTATAAATAATTCTTATCTATGGCCACATAT CTAAATTTTAACACTGATAGAAAACATGAGATTAAAAACAATACAATAATACAGAAGAAAAAAGAAAAGAAATCGCATTA TTTTCAAATTGGATATTAAATGTCAGAAATAGCACAGCCACAGGAATAGAAGATACAGAAAATGAAGATGATACATGGAT AAAAATATTAGAGCGATATATTTTACAATATGAATCAAATCCAATCGAAAAGATCTCGACAATAATATATAATAATTTAA GCAATTGCTTCAATGACATTGAATATTTAAAATAACAAGCAATAATAATGCCAAAAAATATAACAATAAAAAATATTAAT AATTATATACTATCCTTAATTCCTGGAGAATTAAAATCTTACTATAGTCATGACACAATCCTTTCTTCAACTGAGAACAT AGATGACCTCAATCACTTATATCCTGAAGATTTCCTTCACACTTTAGACATTAATGGAATACCACCACATCAACTAAATC TTAAACTAGGAACCCCTATTATGTTATTAAGAAATCTAAATCAATCTATCGGATTATGTAATGGAACAAGACTTCTTATT GCACAGTTAACAAATAAAATTATAGAAGCACAAATCATAAACTCAGACAATATTAATGATAAAGTATATGTTCGAAGAAT AGAAATGACTGTGCACGAATCTAAATGACCATTTACATTAAAAAGACAACAATTTTCCATAAGAATTTGCTATGCAATGA CAATAAATAAAAGTCAGGGACAATCATTGAATAAAATTAGACTATATTTAGAAAGTGAAAATTTTACTCACGGCCAATTA TATGTTGCTTTATCAAGAACTAAAACCCCTAAAGGATTACATATATTAATCCACAACTCAATTAATAAACCCCCAAACCA TGTAAGAAACATTGTATATAAAGAAATCCTACATAACATTAAATAAGAAATATAAAACATTAAATAAAAATATATAACCT TCAATATCATTTCCTTTATGCCATTACAATAATATATTCCAATAACTTAGAAATATATTTAATTTTATATTACTTATTTC ATCTTGCTAAAATCTATTCTAACTAATATACAATAAAATTACTAATACATATCTCAAATAATGATTTTTCTTTATTAACA ATTAGGAAAAATGGCTACACCAATCCGTACATTAAAGCCAAAGCATTAAAGCCAAATGAAGTCTATCAAACTATGAGGGC AAGAATTTGTAGACTATGGACAAATAATGACTTGGCAACAGGCCATTTAATAAGCCTTGATTGCCTCTTAGTCGACGAAG AGGTAATATCTTTACTATACACTATACTATTATTTCTTTCATCTCATGTAATATTATAAAATAAATAACACCCACACATT TCTTATTTACAGTACAAAGCAATTCAAGCATCAATTCGGGCACGTGACTTAGACACCCTCTCTGAAAAAATTCAATTAGG AACATATATGACATCAACAATTTCTTTGTCACACAAAGCAGGAAAACATACAAAACCGTGCCGCATCCTGCAATGTTACA ATTCGCACGTGCCACAGTTTTCCTCCCACACACGAAAGAGGAACTTCCTATTCCATTCCACAGATTCTACTTCACGGAGT TCGATTAACTCCAGCACAAAATCCAGACAACAAAAATCTTAAGCGGTAATATAAATTACTATCTCATGCCAAAAAAAAAA ACTCCATCCCTAAATTACTCACCTATATTCTGACCATTGTACAGTAATTTGCCAACAAATGTCATTGGAATCCTTACAAG AGTGCAGACAATAGAACAAGTAAATATTAACAACATACAAACATCGCGACACACCATAATGATACAAAATATTAGGTAAA TAAATTTCATAGAAATTAATAAATACACAAAACTCTTACATCACTTAAAACATCCCATTCTAATTTTCATTTTTCCATTT TCTTCTCCTAACATAAATGAAGAACATCAAGTGACTTTGTGGGGACACAAAGCAGATCAATTTGATGAAAATGTCCTCAA ATCAATGAAAGCACCAATTGTCGCATAAAAATACTTACACATAAAAATAAAAGACCTACACAAAAATACATAAAGATATT GATCAATTTATTGCTCAAATCTTAGGAAATGCATATGTATCAAGCACTGTGGTAATAATTTTTTATATTGACCCAGATAT CCCAGAAACAACAATATTAAAAGCAAGGTAACAACAACAATTCATAATATTTAAAATCCAAAAATCTTCTATTACTTCTT TCCATAATCATTCCTACATTTCTCCCTACGGATTCTCTCACCAACATCAAGAAATTGAGTTTGCAACACCATCAAGGCAT CAATCTAATCCATCGAAGAATAAAAAACATAACAACAATTGCTGAGGTCCAGACATTACACCAAAAAAGAACAAAGGTTA CTATCATCATATTTCCTATTCTTTTTTCCTTTTCATTATGTTATTCAAGCCAACAATCTATAATTATCTATATAGGGCAC AAAATTTACAATAAAAGCTACAATAACCGGATTCTTAGCAGAACAAGCATGGTATTACAATTTCTGCCCCATATGGTATC GACAGCTAGAGCAAGCAGGAATTGGTTGGTGGTGCGATAGTCACGGACACATAAAAATAATACCATCTCTATGGTAATAA AAATTCCAAACACACTATTACCAAAATTAACTTACGTACATTACCAATAATAAATAATTTATTTACATAAATCAACTGTA ATTTCATATATTACAGGTACAGATTAACAGCACAAATTGAAGACATAACTGGAGACATGAGCATTACTATATTTGGTAAA GCAGTGCAAGCCCTAATTAAAAATCCATGTTCTACACTAACAATCGATGAGGGCTTCACCGACCCATTTACAATCCCACC AATCATCGCTCAACTAAGAGGACAGGGAAAAATTTTCCAAATATACTTCCAACAAAGAGGGCCACAAACAAATGTGGTAG TTTCAAAAATATTTGAAGGCACAGAACCACTACAACTACTAGCAACAACTGTAGTGCCAACAACAAGGTAAAACAATTTT CCTAATCCCTCCCAATTATAGCTAAAAAGTAATACCTTATCTATAAAAATTATTTTACCATCTCAGCCCTCAAACAATGA TGGTAGATACAGCTTCAACAATAGTAGACCACAAACTCCATATCCAAAAAAATCAACCACACGGTAAGTTATGTACACTA ATTTGTATTATTCATGGACCAAAAACAATATTTCTAATTCTAAATACATATCTAAGCACACTCTCTCCATCACAGTTCTC GATCAAAAGAAGAAGAACCATCTACAAAACGTCCAAGAACAAGGTGATATCACTATCTCTAAATCAAAATATTTCCAATC CCGACTGAAAAAAGGCTCCCAGTTACAATGTAAATAAATCCTTATTAGAACATTATATAGACCTGCTCATGTACAAATAT CTACACATAAACTACTTTTGTATTGTAAAAATTATCAAGACTCCATATAAGATAAGATTTCTTTTCCTCTTCCCCCTCAT TGCAAAGAAAGCTCTCATCTTTAAGTTCCATTACATTTATAACAACTATAAAAAAAAAATTATTACTCGAGGCAATGCGC GGGTATATCACTAG