>DHH_7_1_Mno length=16712;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCGATAATACAAATAAATTAGTCCAGCTTTTTAGAATGATTAGAGACAGATATCAAGAACAAGAAATGCCATCGATGAAA TTAAGACTTATAAGTTGAAGATATATAGATAGTAATCAATATGAATTACCTACTTCGCATGACATAGGTGGCTTAATAGT CGGAAATATTGGTGAATATGAAGAGGGAAGAGATATTATTATCGAAGATAAAATAAATAATTTACAAAAAATTACAATAT TACATCCATCTTATATGGCTTTGCAATATCCTTTGCTATTTTCATATGGTGAAGATGGCTTTCAAATAGATTTGAAATCA GTTACTGTAATGACCAAGAAAATTTTAGAATTTAAATAATGCAATTTATGTATTTAAGTCAAGGATTTTTCCTGGAAAAA AATATATTATGTTATATTTTGTGACTGAAGGATTTATGGAATTAACATTTGTATTCCTAAATTCTGTAACAGATTTCATG TTAAGTTCATGTTTTATGATCAAGTAAATTCGATCGATTAAATTCTCACCGTACTTTAAGGCGGAAGAATTTTCAGTACA TACACAGTTTGAGAATCTTAATTCTAAGAATCTCCAAGCACAATACGAACTAGCATCCAATATATATACAAGAGAAAATT ACAACCAGTATAATTTTTAACAGTTTCAAAGGAAACTTAAGAGAGTGGACAAAAGTACAAGGGGTAGGTTTGTGTGTGGA ATTAGATGAGGTGTGATGAGGGAAATGAAGAGGACTCATGATTAGTTTTTTTCCCTCTCTTTCTTCACTTGGCCAGCCAT ACTTAGGGGAATTATAGCCAAATTTTGGTTAGTTGAGTGTGCTAGAGGGTTTCATGATGATATGAATCAAATCAACTATT TGACAAGAAGGCTTACTTCACTTCTCCCATGAAGCTTCCAACCGGCCAAGCAAAAGGGGAATTAACCCAAAAACTTTGCT AATTAAGCTAGCTTGAGATGCTTAATTAAGAACTAAGATGAGATTAAATAAAGTCTATAAATGTTAGACCATTAGTGCAA GCATTAGGTTAGCCATTTTGCACATTTCCTCTCCTTTTCCCCACACCAAAACCGGCCACACTCCACCTATTTCCTCTCAA AATTTTCTCTCACTCTCCTAACCTTAAGCCACTAGCAAACAATAGAAGAAGAAGAAGAAGAAGATCAAAGTGTTCTAGGA GGAGTCTAGTTAAGCATTTCTCCAAGGGTATAAACTAGGGGTGTAAATCGGCTGGGTAGGGTAGGGTTGAGCCGAAAAAT TGAGCCTACCCGACCAGTGCGGGTTGAGAAAATTTTGAGCCGCGACACTTTCTTAAATCTACAAACCCGCAACGTTTCGG GTGACCTCGGGTAGGGTAGGGTTACTCGGGTTACTCGGGTTACTTGGGTTGGTGAAAGCAGATAACTAATATAAAAACAA CTAGAATATTTCAATTAGATTGGTACCCTTCTAACATGCATAATAGTCCATATAAAATAAATAGTTTAATCTAGAATAAA TAATCCATATAAAGATAAACAGTCCATATAAAAATAGTCACAAAATAGGACATGAAATAAAAGTTAGTCCACACCAAACT GTTTAATCCAGAATAATAGCATCTTCATTCCCAACTTGCCCCTCATGTGTTGCAACAGAATTTGACAAATCTTGAGAAGA AAACATAACAAAAAAAATCATCAGAATCAAGTTTAGAACAACAAAATAAACAACAAGGAGATGAAATAAAATNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAACAGAGTGTTTGTGTATATTATATATATA TATATATATATATATATATATATATGTTGCATTGTTCACGGGAGGAACCATTTAGGTACGATGTAGAAACAAGGAGAAGA GATGGCATTGTATCTCGTGGTTGCACACTTGGACTTAAACTGTATTCCATTGAAATCCATGAATAGTACTTAAATTGTAT TTCTTACCATTTAATCATTTCAAAAAATATGAGCATTCTAGCAAGGAAACAATTAATTGATGGCAAAAGTCTAAGCAAAT TTTTAGGGCCTGTTTGATTATAAGAGATGATAATTGAGAAATAAAGGATAAACGGTGGAATCTGATCAAGAAACATAATA TGGAGATCCTCTCCTTTCATTCATTTTTGACATAACTAAGAATAAAGCTTTAAGTATATGGAAATTGATAAAAAAAAAAA AAAATGGTTATGATTCTTTTAGAACTTGAACGATTATAAGTATTGTGATGATTTGGTCATTTAACTGCTTTTAATAGAAA TATTAGTCATCTTTTTTTTTTTTTCCTTTGGACAATTTTAGTGCCTCTCCTCAAATTTATTATGACAATTTGAAATTTGA GATAACAACATTGAAGAAAGCTTAGCAAGCAACACATGAATTCCAAACCGTTCTCTTACAAAAAGTATTGAAGAAATACA ATGTTCTCGCACATTGAAAAAAGTAGGCAACACATGGCAAACTCAAGAAAGTTATTCTAACCTTTCTATTTTCAATTGCT CACTATTCTTCCTGAATTCCAAACCAGAAACCAAAATCTTCAAAGTCTTCACTCTTCTTCCTCGGCTGGAAACAAACAAG CAGAAACAAAAAGATCCACTCACGAGCAGAGCCAGAAACAAACAAGCAGAAACAAAACCAGGCAATCAAAAACAGAAAAC TCTAAGATTTATTGGATTTCAAGCATTTGATTCTGAATAGTTTGAGCCATAACAATATAACCCTACTTATTCCTCTATAA TAGTTTGAGCCATAAAAGAGGAATAAGTTAAATCATATAACCCTACTTATTCCTCCAATCTGTATACCTAATCAAGACAC AATCAACATTCAAAGTTAGGCTTTCATACAAATAAAAAAATTCAAAACGTGGAAGCCCTGCCACTATAAGGCTCTGTGCT GCAGAAAAATTCAAAACAACCCCAGCTTTTGCCTATAAATACATTAACATCTGCATTGAAACATCAAGGCTAGAACTTAC CAAGAGGCAGCAGCTCCTCCTCAAATGAACTTTCAGAAGAAAATGAGAGAGTAAGATTGCTAAATTGAACAAGAGGCAGC AGCTAGCTCCTCAGTCCTGCCCTGTGTCAAAATTCAACATGCAGCCATTAATTCAGGCATCAATTCAGGGAGGAAAAATT CAACATGCAACCATCAAGAGGCAGCAATGCTTCAAGCTATTTCAATCTGAAATTTAATAAAACTAAACCGGTGATAACAC AACAAGATTGCTTTTATTTATTTCTCATGCTAAAAACGACAACAAAACTAAACCTTCTCAACAACATTCACTGAAATGTT GGTTATTTCAGTTTGGACGACTGAAATGTTGGAATAAACTTTGGTTATTCCAAAGTTTATTTCTTTCTCATGCTTTTATT TCAGCTTCGTGTTAATGTTGGTTTGGAGTCCAAACCAACATTAACCCTAATCTGATCAAACCCAAAACCCGGTGAAACCG GTGATAAGTTGATAATCCGGTGATAATCCGGTGATAATCCGGTGATAAGTTGATAACACACATCAATCAAGAAAAAAAAA CACTTACGGTGAAAAAAACACGCAGATTGAGCGACTCAGGCTTGGGAGGCGAGCAAGGGAAGCTTGAAGTTAAACCGGAG TGGGGTCACGGCAGGGGACTGGGAGTCAGCGGTGCCGGTGCGTGCGAAGGCTGGGACTGAGAGGCTAGGACTGGCGGCGG CCGGCGAGTGGCGACTGGGTGGGTGGGAGGAAGGAAAAATGAAAACTAAAAGTGAAGGAAGTGTCTCACATTACACGGGT TTGGGGATTAGGTTTACTCTCTGTTTCAGACTTCAGTGTCTCTCAGACTCTCACAAACACACACAACACATTACTTTGGG TTGGGCCTGGGGGGTCTCTCATTAGATTACTCATTAAACGGCTGGGTCGGGGCAACTCGGGTGAGTAGTTGCCCCACCCG CGGCCCAACCCGCAAATTGCGGGTTGGGCCTATTATAATCCGAAATTTTAAAAAAAAAAAATTAACCCAACATTTTCGGG TAGGGTCGGGCGGGTTTGTCGTGTTCGGGTTCAATTCTTACACCCCTAGTATAAACTTTAAACCCTTTCATTCTTATGTT CTAGCAAAGTTTAAGATTTAGAAATATTCTTCTCAAATTTTCTTATACTCTTCTAGTTCCAAGCTATTAACAAACGTTAG AGGAAGAAGAAGGTGATCAAGGGTTCTAGGAGGAGCCAAAACAAGGATTTTCTTCAAGGGTATAAATTCTAAACCTTTAT CCTCTATTTTTCCTACCAAAAATTAAGTTGTGGATCAAGGATGTAATTTGTGGTTCTTGAGGAAATAATTTGTAATAAGG GTGTGTGAGTTTTATGTTAGTTTTATGTGTTTTGAGGTCATTTTGATTAGCATTATGTGGAATGTTTAGGTTCGGTTTAA GTTTACGTATTTAGGGTTAGAGGAAAATTTTTCTGGTTACTTCGAACACAAAAATGAGGACACTAGAGCGAGATTTTTTA GCATTTCTAAGCTTAAACTTATGGTTCTCGATGTTTTGAACATTTTTCTGTAACTGTGACAAAACCCAATTTTAACTATA AAAGTAAGTTTAAAGCCATTTTACAAAAACGGATCAGGCTGTCCAACACAGTTTCAGGAAAAAAAACAGCAGCCACTGTT TTCAGCCAAATGAGACCTTTAGATGCTGAATTTCAGTTTTCTCTAAAAATGACAATCTTAGATCTTGATGAGACGAAAAA TTGTTACGAAGAACAGATTTTTGAAATCCAACTCTAAGATACAGTACAATGCAGATTTTAGAAACTGCACAGTTTTAACT AAATAAAACTAACACAGTGTGGTTTTTAACAAAAAGGTTATCAAAGAACCCGAGATATGATTTTAGTAAAATACTATGGT GTTAAACCTCATTTTAACGGAAATGTTCGTAAAGAAAGTTTTCAAGAAAAATGGTTTCTTTTAAGAATTTAATGGTTTAT CGAGCAAATCATCCCGACGGGCACCTAAGAGCCCCAATACGTTAGGTCCTTAGAATTTCAAAGGTTAGATGTGGGTCCAA GCCCGCATTAATTGAATAGACCCCGTTTGAAGTTAAATTGCAAAGGCCTAAGAGTTAGAACGCTGCAAATAAATTTCTAG GCTGAATTGGGCCTTAATATCATAACAAGTTCAATAAGGTAGATTATGGAGAATAAGTTACTAGATTGGGTAATTGATTT TCAATCTAGGCAAGTGGATGATAAGGACAATTAAAGAAAATAAGATTGTTAGGATTTAATAAATTGATCCTTATAGTTAA TTATCCTTCATTAAAGGAGAGGAATACATGCCTTAAGGAAATGGTTAGATTTCCGTCATAAGTTGCTAAAGTAGAATAGC AAACGACAGTTAATCTCACACTCTCAATGTGTGTTCATTTTCAAAAGTAAGCAAGTAAGAGAGTAGGCTATTTGGCGAAA AGAGAATTCCAGCTCTGTAAAATCAAGTAAGTAGGATTCTCGCCTACAGTATAAATAGATTTTTAAAATAAACAGTACAC ATGAATTATATGTGTTTGAGTACATTCAATGCTATGTATGCTATGCTAGGTCATGCTGCATACACTTAAGCATTACACAT GAATTATATGTGTTTGAGTACATTCCATGTTATAGTATGCTATGTTATGTCATATTGCATACACCTTAATAAGTCAAGAG GAACTTATAAAGAGTAATCTCAGTTGAGTGTCGTACCAGCCTCTAAGAGGGAGGTAACTCAAGCTCCGCAAGGGAGAAGA AAAAAAATATAATAAAGTCCTCTGAGAGGGAGGCATTTAGTTCAGTTATAATCATGGTGACATTGGGGACCTTGCAAATC CTCATGTTCTGATGATTGCGCGCAAGTGCTACGAGCACTCGGGCCCATAAGTAAGTAAGATAAGATCAGATAACAAGAAT TTAATAAGACATGATCATAATTAAGCATAATTGGTTCATGCATATTTATTCATGTGAACTTACTGTTATTTTTGCGAGAG ATAGTTCCTACTTGCTGAGCGAAAGCTCATCATAGAATATTTATACTGTAGGTAAGCAACCTGCGTATAATACTTGATGG ACTGACGGCGAATGGATGAACGATATGGAGATCAATGAATGGATACCGCTCACAAATATTCCCGCAATCAGTTTTACGTT ACAAGTAGTTTTGCTAATTATGATTCTAAAACTATATGTTAAATGGTTTTGTGGATTATGGTTGTTAGTAAGCAAGACTT ACGGAGTAAGTATATACATATAGATACATCTATATGCAAGAGAAACAGATATATTAAGGTTTGAATATTTTGATCAAGAA AGCAATTCATAATATATGTCTACTATAAGACTTTTTTTTTTTTTTTTTTTAAAATGTTCCGCAAAATCTAAGAAAATTTC AGTAAGTACACGTTAAAATTCAGCTACAGTGACGGCCACTGAAGAAGGTCGTCACAGTTACACATAATTCAAATAACAAA TTTACTAGAAAGAGGATTTCCATGCGAGAATTCTATTGTTATCAATTGTAAGAACGTGAAGCCCAAGGCAATACTCTCTT TAGAGGTGACAGACTATTCCAGCAATATGTAGTTGATGCATATGCCTCTGTAGAAGAAGACCTCCTAGACTATGTTAGAA AAAATAAAATAAAAAATAAGATCTGAGATTTACCAAGGAATTCAAGATGCTATTACTATAGGAGATACAAATGCACAAGC AATAGGAAAAAGAATTATTCTTCCTACTAGTCACACTGGAAGTCCAAGATATATGATCCAAAACTATCAAGACGCAATGG CAATTTGTAGACACTATGGAAATCCTGATTTATTTATAACATTTAGATGTCACCTAAAATGGCTTGAGATTACTAGAGCC CTAGCAAAAGTACCTGGCCTAAGACTTGAAGACAGACCATATATTATTACAAGGATTTTTAAAATGAAATTAGATGATGT TTTGTCCACTATCAAAAATAAATGCTTATTTGGAGCAATTGTAGGAGGTCTGTACGCTCTTTAAAAATTTATTTCGTTTT ATAAATAAAAAACAAAAAATTATTCATCACTTTTCTTATTTAATCAAAATTAAAAAGATTTCTTTTCTAAATTCTCCAGA CTTACATGTCGTCGAATTTCAAAAATGAGGGTTGCCACATTGTCATTTCCTTTTTTGGCTACATCCTGATCAAAAACTGG GCCAGCCTTTGGAAATAGATAAATTCATCTCTGCATAAATACCTAATCTTGAAATGAATCCATTGGAATATAATGTTGTA GCTGAATTTATGATACATGGACCATGTGGCGTTGCTAAAACAAATGCTCCATGCATGAAAAAATCACAATGTTCAAAAAA ATTCTCAAAACAATTAAGAAATGAAACAATCATTGAAGAAAGTAGAATTGTTAATTATAGGAGCCGAAATACAACTCTCT ATGTCCAAAAAGAAGACATTAAATTAGACAACAGATTTGTAGTTCCCTATAACAAAGAATTATGCCTCAAATTCCATGCT CACATCAATGTACAGATTTGCTCTCAATCTATGCTTATAAAATATTTATTCAAATATTTAACAAAAGGGCTAGATAGAAT AAGAGCCGTTATAGAAGAGAACATATGTATAGAAAAAGCTGGAGAAACGAAATAAAAAATTTTATTTATTGTCGATTTAT AACACCATATGAAGTAATGTGGCACTTATATGAATGTCCAATACATCACAGGAACCCATCTGTTCAGCGACTATCTACAC ATTTGCCAAAAATTTAAAATATAACATTTCACTCAAATCAACATATTAATAATATAATAAGACAGTCTGGTATCCATAAA ACAACTCTTACTGAATGGATGGAAACTAACAAATATGACACAAATGCCAGAGGACTAACCTACATCAAATTCCCAAATAA ATATGTTTGGAACAACAAATGTAAATATTGGTCTCCTAGACAGGCAAGACATGCAATCGGACGAGCATTTTATATACATC CAAGCTCTGGAGAATTATATTATCCAAAATTGTTGTTAAATCAGCGAAAAGGAATAACATCTAATGAAGTCCTTCGAACA ACTGACAATATTATATATCCAACATATCAAGTAGCTTGCTATGCACTAGGCTTACAAGGAAATGACAAAGAATGGGATGA ATCAATATCAGAAGCTGTATTTTGGTCAACAACACCCCAACTACTTAAAAGACATTAGAAACTTATGACAAATGATATCT TATACAAAATTAAGACCTTATTTCATAAACCAACATTTCAAATACCTGAAATTGAATTATACAATTTTGTACTATATGAA TTAGAAAAATTATTAAATTTGAACTCATAAACTCTTAACACATTTCAATTTACCTCTTCCTACAGGATCATTGGTAGAAG ATCTAAATAATAAACTTCTAAGAAAAGAGCTCAATTACGACATAAATACATTAAAAGAGAAAAATACGATATTAGTACAA AATCTAAATAATGAACAGCGATTTATTTATGAAGAAATCCTAGAATCACTTAATCGCGAAAAAGACAACATTTTTTTCAT TTATGGTCAAGGTGGAACCGGAAAAATATATCTATGTAATGCAATCATTACAAAAATTAGATCAAATAATCAGATTGTTC TTGCCATTGCATCTTCTGGAATAGCATCATTATTGCTACCTAAAGGAAGAACTGCACATTCTAGATTCCGAATACCGTTA TCAATAGATAAATTTTCTACTTGCCATATAAAAAAGGGAACGCAACTAGCAAAACTAATAAAAAAAAATATCACTTATAC TATGGGATGAAGCGCCTATGACCAAATTATATTGCTTTGAAGCATTAGACAAAATGCTTCAAGACTTAAGAAATAACTTC AACCAACCATTTGGTGGCATGACTATTGTGTTAGGTGGTGATTTCAGATAAATTTTGTCTGTTATTCCTAATGGAACAAA AGAAAATATCATAGATGCGGCCATAAATAATTCTCACCTATGGCCATATCTTCGAATATTACCATTAACAGAAAATATGC GATTAAAACGCTACAACATCACTGACAAAGAAAAAAAAGAAATCACAATTTTCAAACTGGATATTAAGTATAGGTAATGG CACTAGAGAAGGAATAAAAGACCCAGAAAGTGAAGATGCCACATGGATAGAAGTACCAGAAAGATACATAGTGCATTATA AATCAAAGCCAATCGAAAAAATATCATCATTAATATATGGCGATTCAATTATTACCTCAACAATATTGAATATTTAAAAC AACGCTCAACAATAACTCTAAAAAATAAAACAGTTGATGATATCAATAATCATATATTGTTATTAGCGCCTACTGAATTG AAATCTTATTATAGTTATGAAACAATCTTATCTTCATATGAAAATATAGATGACCTAAATCTCTTATATTCTGAAGAATT TTTACATACTTTAAACTTTAACGGTATACCACTACATGAATTAAATCTTAAAATGGGAATTCCAATCATGCTATTATAAA ATCTAAATCAATCTACTGGATTATGCAATGGAACACAATTCATTATTACACAACTAACAAATAAGATTATAGAAGGACAC ATAATAAGTTCAAATAATATTACTAAAAAAGTGTATATCCTAAGAATAGAAATGACTGTACATGAATCTAAATAGTAATT TAATTTCCTGTAAAAATCTACAATGCAATGACAATAAATAAAAGCCAAGGACAATCTTTAAATAAAGTAGGACTAGAGAT GTCAAACGTATCATGCCGGGGCGGCACGGCACGTCCAACCCCAGGCCCATGGCGGGCTTGGCACGACCCTGCACAGTGCA GGGTAGTGCCTGGGCCGGGCCTGAGGAGAAAAACTCAAGCCCGGTCTAGGCCCGTGGCCCTAGCCCGGCCCTGGCCCTTC ACGGGTCGGCCCTGTCCCTTGTATTTTTTTAAAAAAATTTAATTAAAAAAGAAAATATATCATATGCCCCCAAAAGATGT TATTCTATTGAATTGGGATAATACAAATAAGTACACATAAATGACTGTCTTGTTAAAAACCTTGCCAAGTAAAACCCATG GGGAGATCGGGATAAAACCTTAGCGAAGGAAAAAAAAATGCAGTGGGAATAGTAAATTACTAACCTAAGTGCTTCAAGAA GATTCTGTTATTTATAAGTTAGAAAAATAGTCGTGCATTGAGTCATCCATGTACTGTTATTTTTGTCTTCTAGCATCTTC CCAGTCTTTAATGCACATTAGCCCCTCCAAGATATCTGGATGCATTCTGCTTCTCTTCTCGTGAAGAATTCAGTTGCTTG TGCTAAATGCTTGCTCCAATGCTGCCATTGACATAGGAGTTGTTAGAATGTCACGAGCTATTACGGACAGTGTTGAAAAA CAATTAGTCTTGCTCTTCCACCACTATAAGTTGTCTAGTTTGTCGTCATCGATTACAAAATTTGCTTCAAAACATTATAA ATTGTGGGCAGAAGGCCGTCTGTATGAATTCTTTGAATGATACATTATCTGCAAAAGAAAGAGGCAATTCGGCACTAGCT AAAAATTTAGCTAGTACCTCATGAGCACGTTGTGCATCGTATGTAAAATTTTACAACCCCTGTGATGTGAGTGATAGTGT TTGTTGGCGGGAGTCCACACTCCAACCTTGGTGCAACGGTAGACATACTTTTCAATGTCTATCCAAATGACCAGTACCCC TACCCTTTTTACTAGAAAAGTGTTTTTTACAATACTTAGATACCGCACGAATTTCTATTTCACTTGTTTTTAGATTTGGT CGGGGCTCCTCGGTGAAATACTGCCATGCGGGAGAAGTTCATGATCTTTTTCTCCTAGTGCGTTCTCCAGCTTCTTCATT GTGCACTGAAGCATTATCTATCGGACCAGTTTTTGGTTTAGTGGGGGTGGGGTTGGGAGGCATCATTTCATCCTAAAAGA ATAGCTCATCACCAAGCTCAGGAGGAGCAGTGAAATCAGGGAAGTTTGATGCGGCCAATTTATGGAAATTAATTGAACTT AAACTTTGTAAATGAAAAAGCAAGAAAATGAGTGATCATGAGAAGAGAAACTTAGAATCAAAATCAAAGAGACAAGATGA GAGCTAGAATAAGAGTGAGATGAGAAGTTGAGAGTGAATTGTTGTGTGGAATTTAGGGTGCAATTAAGGGGTATTTATAG GGAATTTTTGGGGGGTTTTCAGAATGTGACTGTTGGGCCTGTACCGTGATCGGCCTAACGGGAGGCTCGTCACGGGCCGA CCATTAGGCCTGTGAAGGGCCTTACGGTCACAATCTAAATGGGCTGCGAGCCGTTTGGTGGGCCATGTCGCGGGCCTAGG CCGGGCCGAACAAGGGCCAAATCTGGGCTTGGGCCGGGCCACGGGCCTTCACGGGCTTGGGCTGCAGGCTGAGAAGCTGA GGTCCAGCCCTAGCCCATCAAACGTGCCGGGCCGGCATGGCCCGTAACAGTACCGTACCGGGCCGTGCCGAATCTGACAC TATTACGAGCTGGGCCAGGCCGTCCATAGAGGACCCGGCCCATTTGATAACTCTAAGTAGGACTATATACGTTGCTTTAT CAAGGGCAACAACTCCAAAAGGATTACACATATTAATACATGATTCAAATAATAAACATCAAAACCACCTTAAAAATGTA GCCTACAAAGAAATTGTGCACAATATTAAACAATAACGTAAACTATTGCATGATAGCACACATAATTACATTTTGTTTAT ATGATTAAAATATTTTGTTACCAATAATCTATATGCATATTGAATAAAATTGTTTCCTCATGTAAAAAATAATCACTTAC TATTTCCAACAATTAGGAAAAATGACAACTCCTATTTGTGCACTGCGACCAAATGAGGTCTACAACACCATCAGAGCCAG AATTTCCAGATTATGGACAAATAATGAGTTCACCATCGGTGTCTAATAAGCTTAGATTGAATCTTAGTTGATGAAGAGGT AATATTTTTTTATAAATACTAGATTATATAATATTTTATTCAATATTTAATATTACACAATGACTAATTTTCTTACATTT TAACCTGCAGCATGAAACGATTCAAGGATCAACCCGAGCACAAGATTCAGATATTGTTTCAAAAAAAATTCAGCTCAGTA ACATATATGACATTAGCAATTTCTTCATTACTCAGACCAAGCTAACATATAAAGTCGTACCACACATTGCAATGCTTCAA TTTGCATGAGCAACTTCTTTCACTCCAGTAACAAAAGAACTACCGCCAAATCCCATTCCACAAATTCCATTTTACTGAAT TTGATCAGGTACAACAAAGAGTTAACACCATCAAAATTTTAAGCGGTAACACAAATATTTTACATTAATTGATAAAAAAC ATTATCGGTTGATCAATGCAAGTTAATAACAAGTTTTATGTACTTTATATAAGATGTTATTGTAGCCATTAAAAGTGTCC AAGCAATTGAGCAAGCAAACATCGGCAGCAGATCAACATCATGGCGCACCGTTGTCATACAAAACATAAGGTAAATATAT TTCAAACATCTTTTACCATAATAAAATTACAAATCATTCAATAAAAATAAAAATCTCTTTTGTTACTAAAGATTAGTATT CTAACATATCTTTGCTATTTTATTTCCTTAACAGAAACGAACAACTACGAGTCACCCTATGGGGTTACAAAGCAGATCAA TTTGATGAAAACATACTAAGATCTATTGGACCACCAGTGGTGGCAGTCATTGTTGCGATGTTCGTTAAACAATATCTAGG TATGCTTTAAAAACCTAATCACAACAATTACAAACACAAATAAGACTCCTATAGGAAAATACCAACTAATCAAATATCAA TATCTTAGACAATCCATATGTATCAACCACCGTAGCAACAATCTTTTACATCAATCCAGATATACCAGAAACAAAAATGT TAAAGACAAGGTAATAAAACTAATACGAAATAGAAAAAAAGAGAACTATCCTTCTTTATATCTAAAAATTCGTATTATTC TATCATATAAATACTTTTGATTTTCTATAAACAGATTTTCCCATCAAAGTCAACAAATCGAGTTTCTACCAGCATGAACA ATATCTGCCCAGATGATTGAAGAACAAAAAACAGAAAATAGAAGAACAATCAATGAACTAAATGCAATAGATGCAAAAAC AACCGAGTTAGTATTATTTCATTTTTCTGTTCTTTTGTTAATCAAATTACTTAAACTAATATGCTCTTTTATTCATTCAG GGCACCAAATTCACAGTAAAAACTGCAATAACTAGGTTCACAACAGAACAATGATAGTATTATAACTCCTGTCCTAGATG TTATTGACAACTAAAGCAAACAAGCCACGGTTGGTGGTGTGACAGTCCCGGTCATCGAAAGACAACACCGTCTCCATGGT AATAAAAATTATTGATAAATTATTACTAAAGCTGATATACCACTATTAATCACAATAAATAAAGAACCATATTAATAAAT GATTATTACATATGTTACAGGTATAGATTAAATGAGGAAACCCAAGATGCTACTGGAAACATGAAAAGCATTATATTTGG ATGAATAGCACAAGCATTGATTAAGAAACCCTGCTCTGCGCTAACAATTGATGAAGGTTTTACCGATCCATATATAATTC CACCAGCAAATGACCAATTAAAAGGACAAACAAAAATCTTCTAAATATACTTCTAACAAAGAGGCACATAAATATCTACA GTCGTTTTCAAAATATTTGAATATACTCAACCTGTATTGCCACCACCACAGATACCAACCACCGCAGCAATATACCTAAA AACACCAGACCCAAAAAAAACTACCATATAGGTATGACATATTTACAAATTAATATCAATTATTAGTTAATATTATACTT TAATAACATATTTACAAATTAATATCAATTATTTGTTAATATTATATTTTAATATTTATAAAACTCATTTTAATCTTCTT TTATGATTTTAGCTCCGAATTAAGACCAACAGAGCAATCTAAAAAAATACAATAACCAGGTAATATCACAATTTTTAAAT GCTTAATTTAATACTTTATATGACTAAAATTATTTAAAACTTCCAAAAAATCATCACTAATTTTTTTTAATTTTTATTTT GCAGCACCGAAGAAGCGCGGAAAAAAAAAAGAAAAACAGAATATAATATACAACAAAAAAGTTTTGGCCTATATATGTCT ATGTATATATACACTGATACTGTAGTTTTTTCTCAGCATTTTACAAAAATATATATATGTATATATATAAACTAATACTG TACTAAAAAATCTTCAGACTTCTAATACAACAAAAAAATCTCCCCAACAGCAACGCACGGGTACACAACTAA