>DHH_6_1_Mno length=16925;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCATTATTATATATTTTTCCCTATTATTTCATTCTCATTAGATGATAGTGAGAAACATGTAATGTAATAAATTTATCAAT TAAATTCATTATTGGCTTTTTTCTATTATTTCCTCCTGATAAGATGATGGTAAGAGAGATGTAATGTAATAAATTTTCAG CTAAATTCATTATTAATCAATTATTATGACTGGAGAATTTTGATATGTATAGAAAAAAAAAATTAGATTAAACAATATTA GAACATTAACTGCTAGATCATTTATTACCGAATTCAATATAGCAATCTACTGCCTTTTTTTCCCTAGATTACAATTAGTG ACAGCCACATTACTTAGGCAACTAATCCTATTCTTTCTTCATAATTGCTAAACTAATCTTAGATTTTAATCTACAATGCC AATTTATACTTAAGAAAAAAAAAACCATTAAACTTAATTTATATAAAAATCTTAGATATTAAACTAATTCTTTATAAATA AGTAAAATATCCATAATTTTTAGCTTAAGATAGCAATTTAAATTATAAACCTACATCAGTTACTGTAAAGTAACATTTTC CTTTATCCGTCAACAGCCAAAACAATATTATATTGCATTCACCAAATGGATGAGACAAAAATTAGGAGGAAACAATCTCA ATCAAATTAACATATGCATCGTATTATTTCAGAAATGGATCGAGATTCTCAGAACGCAATTACTGAACATTGAAACCAAC CTAACCAAGATAGCGCATCCGTATCGACAACCCTTCCATCCAGATTTGATGCGATGCTAATTCCTTTCCAGTCTTAACTG AATACTATGCCATCCCCGTCAACATCTTGCAGCTACAATCAACAAAGTAATTTCCCTATCCATAATAATCATTACATTCT AACGATTAAAACTCCTTTTATAGTCAAAAAATTAATTCCTTATATGTTGATCCCATAATTGCCATTCATTTTTATTTATA GGTACTCTCAATATGTATATTGATATTGGAGATTGCTCTTGCACCTGTCAATATTTTGGTGCTCTATTTTGGTTTAATGA ACGAGTAAAAAATAGAAGCTCCCCTGCATTTAATCTTTGTTGTAGAAACGGCAAAATAAAGTTGCATTTACTTAGACAAA CACCTGTTGTATTAGGTGAACTACTTAATTATCATGAACGTCCAATAAGCAAACATTTCCCAAAAAATATACAAACATAT AATTCTATGTTTGCTTTTACTTCATTTGGAGCAAACATAGGAACAAGTACACAAAATTCTGACAGTCCATATATTTTCAA AATAAATAGACAAATACATCATCTTATTAGATCTTTACTACCAATTAACAATAATTCTCCAAAATTTGCATAGCTTTATA TATATGATATAGAAAATGAAATTGAAAATCGATTATCATCATTCTCATTTGATGACCAATCACAAAATTTCACCAGATCA ATAATTGAAAGTTTGATTAAAATGCTAGATAATACAAACGTATTAGTCAAAACATTCCGAATGATAAGAGATAGATATAA AGAATATACTATATCATCCATGAGATTGAGACTTATAGGCTGAAGGAACACCGACAATAGTCAATATGAATTGCCAACTT CAAATGATATAGCTGGTCTAATAGTCGGCGACATCGGTGAATATGAACAAGGAAGAGACATCATAATCCAAGACAGAATA GATACTTTACAAAGAATTACAAAATTACATCCATCTTATATGGCCTTGCAATACCCTTTACTATTTCCCTATGGCGAAGA TGGTTTTAGAATAGATCTAAAAACAATTATACATAACCCAAATAATAAATCTGCAAGAAAAAGAATTTCTATGTGAGAAT TTTATTGCTATCAATTGCAAGAATGCAAATTCCAGGGCAACACTCTTTTTAGATGAGGAAGACTATTCCAACAATATGTA GTTGATGCATATACTTCTGTAGAAGAAGATCGTCTAGACTATATTAGAAAAAATTAAAAAAATTTAAGATTTAAAATTTA TCAAGGAATTCAAGATGCTATAACTAGAGGAGATACAAATGGACAAGCAATAGGAAAAAGAATTATTCTTCCTTCCAGTC TTATCAGAAGTCCAAGATACATGATTCAAAACTATCACGATGCAATGGTAATTTATAAATTCTATGGAAATCCTGATTTA TTCATAACATTTACATGTAATCGAAAATGGCCTGAAATTACTTGAGCCTTAACAAAAATACCTGGTTAAAAACCTGAAGA CATGCCAGATATCATTACAAGGATTTTCAAAATGAAACTGGATAATTTTTTATCTATTATCAAAAATGAAAAAAATATTT GGAACATTTATAGCAGGTTAGTGCACTCTTTCAAAACTTATTCAATTTTATAACTAATGAAAAAAATTTTAATTATCTTC TTCTCCTCATTTAATTAAAGCCTAAATGTTCTTTTCCTCTTCTTCATTTTGTAGACCTATATGTTGTTGAATTCTAAAAA CGGGGGTTGCCACATTGTCATTACCTATTTTGACTCCAACCTGATCAAAAATTGCATGAACTATCACAAATAGACAAGCA CATTTCTGTAGAAATACCTGATCCAGTAAAGAATCCATTAGAACATAATGTCGTAGTCAAATTTGTGATCCATGGACCAC GCGGTCTATCTAAAACCAATGCTCCATGCATAAAAAATTCACAGTGCTAAAAAAAAAATCCCAAAACAATTCAAAAATCA AACAACTATCGAAGAAAATGGAATACTAAATTACAGACGAAGAGATACGGTTTTTTATGTACAAAAAGAAGGCATAAAAT TAGATAGTAGATATGTAGTTAGTTCCCTATAATAAAAATCAATGCATGAAATTTCATGCCCATATCAATGTAGAAATCTA TTCTCAATCTATGCTCATAAAATATTTATTCAAATATCTGACAAATGGACCAGACAGAATAAGAGTGGTTATAGAAGGCA ACATCTGTACAGGAAAATCTGGAGAAATAACTTATAAAGAAAGAGATGAAATAAAAAATTATATCAACTGTAGATATATA ACGCCATATGAAGCAATGTGCCGTTTATATGAATATCGCACACATCACAGAAACCCTGCAATTCAACGCTTATCAATACA CTTAGAAAAGTCACAAAATATTACATTCAATTTTAACCAATGCCTTAATAATATAATAAGACAACCTGTTATTCACAAAA TAACTCTTACTGAGTGGATGGAAACCAATAAATACGATATCAATGCTAGAGAATTAACTTATATTGAATTTCGAAGCAAA TATGTTTGAAATAACAAATATAAATATTGGTCTCCAAGAAAAACAGAACATACAATTGGACGAACCTTTTATATACACCC AAATAGCGGAAAATTATATTATTTAACACTATTATTGAACCATTAAAAAGGAATAACAAGTTACGAAAAATTTCAAATAG TTGATAACATTATATATCCAACAAACCAGGTCGCATGCTATGCACTAGGCTTACTAGGAGATGATATAGAATGGGATGAA TCAATATCAGAGGCTTCACCTTGGTCAACATCAATCCAACTACGACAACTATTTGTCACAATCTTATTATTTTGTATTGT CAGTAATCTGATCAAATTATTTGAGAAACATTAGAAACTAATGACAGATGAAGTCTTACACAAGATTAAAACCTTTTTCA ATAACCCAAATTTTCCTGAAATTGAATTACGCAGCTTTGTACTGTATGAATTAGAGAAATTATTAAATATAAATTCATCA ACTCTAACACATTTCAATTTGTCACTTTCGATTGGATCATTAATAGAAGATTTAAATAACAAACTATTACGAGAAGAACT GAACTACGACATAAATGAATTAAAACATCAAAATAATATATTAGTACATAATTTAAATAATGAACAAAGATCTATTTACG AAGAAATTTTAGAATTGCTTAATCATACAAAATACAATACTTTTTTTATCTATGGTCATGGCGGAACTGGAAAAACGTAT CTATGGAATGTAATCATTACAAAGATTAGATCAAACAATGAAATAATTCTTGTCGTTGCATCTTCTGGAATAGCATCATT ATTATTACCTAAAGGAAAAACTGCCCATTCAAGATTTCGAATACCATTATCAATAGACAAATATTCCACCTGTCACACAT AAAAAAAGGAAATCAATTAGCAAAGGTAATTAAAAAAACATCACTTATACTATGTCACGCCCCCCAAACGGGGTGGGTGA CGTGGAGCTCGATTAGGGATTAATAAAGCAGATTCCCAGACCGGGCCCCACACTTAACTGCATTAAAATATAAATGAATT ACATAATCCAGGAGCTTCTGACACACAGGGCTCCACCCCACAGGACATACAGTATCGTACATACATGCTCATGTAATTAA TCAGTACAACAGACATCAACCACAGTCTAGTAAATCCAATATTAAATAGGTTTACATAATTTCTCAAATTCCTTACATTT GTTCAAGAGGATAAACTCAATCCTCACTTGATCCAACAGTAGCAACTCCAGCTACCCTGCACCGCTCCTCGAGTCTCCTT GGAGGGGTTTAACATTTAAAACATAAAACGTGAGCGAAAGGCCCAGTAGGATATAATTTGAAATATTTAAAATAAATGAG CGCATGAATAAATAATTGAATACATAAATAAAATAAGACATTCAGTCCCGACAGAACAGCCAGAACCTCACATCCTTTTT CTCAAAGCAAAAAATAACTGAAAATAACCATGTTACAGGCTTCAGCAAGTAATTAGTACAAATTACTTACCTAACCAAGT GCCTCGCCTACCCGGACTGAGTTTCGGGTTCTGCCCCCGAGGATGCACTCTCCGCATCCTATCTAGGCTTACAGCAATAG ACTCTATTACCAGTTCACAAGATCTCTTTGCTTAAGAAATCATTCATTAACATTTTGAAATCGTTAATANNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNGTGTGAGAGAGAGAGAGAGAGAGAAATGCACGGGAAAGAAAAAGAAAAGGAAGGAAAATA AAGGAAAAAGAAAAAGAAAAGAAAAGAAAAGAAAAATAAAAGAAAGTGACATGTGTAAAATATAACAGTCCAGAAATGCG CCCATACACACTTCTGGATTAAATAAATTACTGTGAATAATTGAAATACCTTGGAATTATTTAAACTCAATTAATTAAAT CAGATTAGGCACACTAATAATCTCAATTACCTTAATTAATCTCAATTAATTCTTCAGGGTGTTACAGCTCCACCCCCCTT AGGCAATTTCGTCCCTAAAATTAAAGCTCACTTCAAATTACAAATAGATGCAGATAACATTCCTGCATCGTCGTTTCAAG CTCACATGTTGCTTCCTCACCACCATGGTGCTGCCACAGCACTTTCATTAACGGGATCTCACGATGACGCAGACTCTTCA TCTTCCGGTCAATAATCTGGACCGGTACCTCATCGTACGTCGTGTCGTCCTGTATCGGAACGTCATACCATTGCACTACA GCTTCCGGATATGGTTGACATTTCCGAAGCATAGAGACATGGAACACGTCATGCACATGAGATAATTCAGGCGGCAGGGT AAGACGATACGCCACAACACCAACTCGCTGCACGATCGGGAATGGTCCAATATACCTTGGCGCAAGCTTCCCTTTCACAC CAAACCGAGTAACTCCCTTACGTGGGGAAACCTTCAACAGAACAAAGTCGCCTTCTTGGAATTCCAAAGGCCTATGCCTT CTGTCAGCATAGCTCTTCTGTCGACTTTGAGCTGTTAATAGGCGTTCTCGAATCACAGCTATCTTCTCATCATTCTCTTG AATGACATCCGGTCCAGTTGTAAGTCTATCCTCCGGTTCCAACCAACAAACAGGTGACCTACAAGGACGACCATACAACG CCTCGAACGGTACCATACCGATACTGGCCTGATAGCTGTTATTATAAGCGAACTCAGCTAGATGTAGGTATTTCTTCCAG TTCCCACCGAATTCCAGAATACAAGCACGAAGCATATCCTCCAGAATCTGAATGACTCTTTCAGATTGTCCATCTGTCTC GGGATGAAATGCAGTGCTAAAATTCAGATATGTTCCCATGGCTTCCTGGAAACTCCTCCAATACCGTGCATTGAAGCGGG TATCACGATCAGACGTGATAGACAGTGGCACCTCGTGTAACCTCACGATGTGCTCTAGGTACAATTCTGACAGAATCTTC CGAGAATACGTTGCACGAAACGGTATGAAGTACGCAGACTTCGTCAACCTGTCCACCACCACCCAGATGGCATCGTGCTT CAGCTCGGTTCTCGGTAGCCCCATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTAGGAACAACAAGGCGGTTGCGGAAATACAAGGTTCCGTCC TCCCGGATTCTCCAATCCTTAAATTGTTCTCCATTCTGGATCCGAATCCAAATCCCTTGGAGGTGGGGATCCTGCCATTG ATTCTGCTTAACTTGTTGCACAATGTCCGGTGTAGAGACCAGATTATACACCATAGCCTGGTTATAATCTTCATAGAACT GAAGATCATACTCACTCAGTCCTTTTCTAATCTTCCAAAGCTAATGACGCCAGAATCCCCGTCGGCTTCTTGCTAAGGGC ATCAGCCACCACATTAGCTTTTCCAGGATGATACTGGAGAGTGAAGTCGTAGTCTTCCATGTACTCCACCCATCTCCTTT GCCTGAGATTCAAGTCTTTCTGAGTAAACAAGTACTTCAGACTTTTATGGTCAGAGAAGACCTGAAACTTTGCTCCATAA AGATAACATCTCCATATCTTTAGAGCAAATATCACCGCTGCTAGCTCCAAATCATGGGTGGGGTAATTCTGTTCATATGG CTTTAGTTGTCGGGATGCGAAAGCTACAACGCGTCCACCTTGCATCAACACACAGCCTAGCCCACTCCCCGAGGCGTCAG TATATACCTCATACAGCCCTTCACTGTCAGGAATAGTCAAGACTGGTGCACTTGTCAGTCTGACCTTCAATTCTTGAAAA GCACTTTCACATTCGGCGTTCCATTCGAATCTGACTTCCTTCCTCGTCAACCGAGTCATCGGTGCAGCGATGCTCGAGAA GTCCTTCACAAAACGCCGGTAATAGCCTGCCAGTTCGAGAAAATTGTGAATCTCCGCTACATTCTTCGGCCTTTCCCACT GTAGCACAGTCTCGATCTTAGAAGGATCGACAGAAATTCCTTGTCCAGAAATCACATGCCCAAGGAACTTCACTTCTGTC AGCCAGAAGTCACACTTCTCCTTCTTAGCATACAACTAGTGTTCTCGAAGAGTCTGAAGAACAATTCTCAAATGTTGCGC ATGTTCTTCCCAAGTCTTCGAGTAAACCAGTATGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGG CCTACGGCGAGGCGCCATTTCCTTCAACTGAAATAAAACTAGACTATTTAGTGGATTACAGATGTCACACATGTATGTAC AATCCTGGGGTTCTTAACCTAATGCTCTGATACCACTCCTGTCACGCCCCCCAAACGGGGTGGGTGACGTGGAGCTCGAT TAGGGATTAATAAAGCAGATTCCCAGACCGGGCCCCACACTTAACTGCATTAAAATATAAATGAATTACAGAATCCCGGA GCCTCTGACACACATGGCTCCACCCCACAGGACATACAGTATCGTACATACATGCCCATGTAAATTAATCATTACAACAG ACATCAACCACAGTCTAGTAAATCCAATATTAAATAGGTTTACATAATTTCTCAAATTCCTTACATTTGTTCAAGAAGAT AAACTCAATCCTCACTTGATCCAATAGTAGCAACTCCAGCTACCCTGCACCGCTCCTCAAGTATCCTGGGAGGGGTTTAA CATTTAAAACATAAAACGTGAGCGAAAGGCCCAGTAGGATATAATTTGAAATATTTAAAATAAATGAGCGCATGAATAAA TAATTGAATACATAAATAAAATAAGACATTCAGTCCCGACAGAACAGCCGGAACCTCACATCCTTTTTCTCAAAGGAAAT ATAACTGAAAATAACCATATTACAGGCTTCAGCAAGTAATTAGTACAAATTACTTACCTAACCAAGTGCCTCGCCTACCC GGACCGGTTTCGGGTTCTGCCCCCGAGGATACACTCTCCGCATCCTATCTAGGCTTACAGCAATAGACTCTATTACCAGT TCACAAGACCTCTTATCTTAAGAAATCATCCATTTAACATTATGAAATCGTTCATATGACCCCACGAACTACTCAAGCTG CGGGCCCCATGACTGGACAAGCCATGAGGTTCCATGACTAGACAAGCTATGGATTCCATGGACAGGACAAGCCAAGGATT TCCATAAACTAACAAGCCATGGTTTTTAAAACATTTTTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTTCCTCAAGCCCCTTCAGTC TGAATCCACAGCGAGCACTGATACAAAACGACACTTTAGGATCAATTCTCAGTCCTAAAGTAATCCAATCTCAATCATAT ACCAAGATTTCCTATTAGTGTGCCCTAATCAAATTTCATGTTTCAATAATCAATTTCCAAGGGTTTTCAATCTCAAACAG GGATTAAAGATGCTAATCCTTTTACCCCAAGTCCCCAAATGAAGCAAATTTGGGTTTTCCCCGAAAACAGGGGTCAGAAC AACAATTTCAGGCTAAACAGGGTAAAACCCCGTGTACACCGGTCGACCGGTGACAGAGAAGTACATCACCACTGGTCGGC CGGTGGTGTGCATCCGGTCGACCGGACCGGTCGGCCGGTGGCCATAGCAAGATCCGGTCGACTGATGCGGTCGACCCGTG GAGAACGCCAGTTCGCGAAAACTCACAGAAATCAGTTCAAAACCTGCAAATCCAGTCGCAATTCACAAAATCTCAAGGGA CAACCACTAGATCCGGGTTCTAGGTACTAAAATAAGTCCAAAGAACCCAAGATCTCCAATTTCTACCCTAGTTTTACTCA AAATCCACCAAAATCCATTTTGAACCAAAAATAAGTTTTGAAATCTGAAAAACATAGATTCAAGAGACGTTCTTTCAGTA ATCTTACCTCGAATCCTTCTCTTGACGTTGAAAACTCTTTGAAATCACTCTTCGTTCGAATCCGGTTTTGATTTGAGACA CAAATGGGAGAGAGAGAGGGAGAGAGTGAGCACGGAAGTGAGAAAGAGAGAGAGAGAGAGAGAGAAACGCACGGGAAAGA AAAAGAAAAGGAAAGAAAAGAAAGGAAAAAGGAAAAAAGAAAAGGAAAGAAAAGAAAAATAAAAGAAAATGACATGTGTA AAATATAACAGTCCAGAAATGCGCTCATACACACTTCTGAATAAAATAAATTACTGTGAATAATTTTAATACCTTGGAAT TATTTAAACTCAATTAATTAAATCAGATTAGGCACACTAATAATCTCAATTACCTTAATTAATCTCAATTAATTCTTCAG GGTGTTACATACTATGGGATGAGGCACCCATGACTAATAAATATTGCTTCCAAGAATTAGATAAAACACTTCAAGATCTA AAAAATAACTTTGAAGAACCATTTGGAGACATGATTGTTGTACTGGGTGGCGACTTCAGATAAATTTTGCCAGTAATCCC TACAACAACAAAAGAAGCCATAATAGATGCCACAATAAATAATTCCTACCTATGGCCACATTTCAAAATACTAACATTAA CAAAAAATATGCGTTTAAAACGGCATAACATCACTAAAGCAGAAGAAAAAGAAATTCCAAAATTTTTAAACTGGATATTA AATGTAGGAAATGGCACTGCTGAACAAATAAAAGACCCAGAAAATGAAGATGCCATGTAGATAAAAGTACCTGAAAAATA CATAATACATTATGAATCAAATCCAATTCAAAAAATATCATCATTAATTTATAAAAATTTCATTTATTATTTTAACAATT GAATATTTGAGACAAGGTGCAATAATAACCCCAAAAAATAAAACAGTTGACGATATTAATAATCATATACTATCTTTAGT ACTAATTGAATTAAAATCCTATTATAGCTATGACACAATTATATCCTCATCTGAAAACATAGATGAACTTAATCTTTTAT ATCCTCAAGAATTTTTGCACTCTAAATTTTAACGGTATACCACCACATGAATTAAATCTTAAGATTGGAATTCATATTAT GTTGTTAAGAAACCTGAATCAATCCACTGGATTATGCAACAGAACAAGGATCATTAAAACACATTTAACTAATAGAATTA TCGAAGGACACGTAATAAATTCGAATAATATTAATGAAAAAGTTTATATTCCAAGAATAGAAATGAATGTACACAAATTT AAATAGTTATTTACACTAAAAAGACGACAGTTTCTTGTAAAAATTTGCTATGCGATGACAATAAACAAAAGCCAAGGACA ATCCTTAAATAAAGTAGGATTATACTTAGAAAGCGAGATTTTTACCCATGGCCAATTATACGTTGCCCTATCAAGAGCAA CAACCCCAGAAGGATTGTACATACTAATACACAACTCAATAAACAAGTATCCAAATCACATTAAAAATGTAGTCTACAAA AAAATTGTACAAAATATTACATAAAAATATATATAATACCATTTCCTTTACACTATCATAACAAATCTTTTGCAACTATT CATATACAGATTCAATAAATTTATTTGATCATATACTAACCATTTATACATTATCTTCAATCATTAGGAAAAATGACTAC ACCTATCCACATGCTAAGACCAAATGAAGTCTACAGCACTATTAGAGCAAGAGTATCCAGACTATGGACAAACAACGAAT TCACTACAGGACATTTAATCAGCCTTGAGTGCATCTTAGTTGACAAAGAGGTAAAAACTTTTATAAAAACTAAATTACAT ATGATTCTATACAGTATCAAATATCATAATATAACTAGCTTTCCTCTCTTCCATATCTCCAGCATGAAGCAATACAAGGA TCAATACGGGCACGAGATTCAGATATCATTTCTCAAAAAATACAACAAGGTGGCATATATGACATTACTAATTTTTTTGT AACACAAACTAAGCCAACATAGAAAGTGGGGCCACATAATGCAATGCTTCAATTTGCGAGAGCAACATCCTTTATCCCAG TCATCGAAGAACCGCCACCGATTCCACTCTACAAATTTTATTTTACAGAATTTGATTAGCTGTAGCAAAAAGTTAACACC ACATAAATTTTAATAGGTAATGCACATTACTTACACAAATAAATCAAAACCTTCATTAATTTATTAACATATATTTATAA CACCTCTTATTTATTAAATAACAGATGTTATTGGAGTCATTATAAGTGTTGAAAGTCAAACATCCAAGGCAGATCAACAT CATGACGTTCCATTATAATACAAAACATATGGTAATCACATTTCACTATCTTTTATCACAACAATGTTAAAAAAATATTC AATAAAATCATAAATCTTTTCCATTACCTCAAATATCAATTCTAATCTTTTCTTATCACTCTATAGTATTAACAGACACG AAGAACTACGAGTCACTTTATGGGGACACAAAGCAGATCAATTTGATGAAAACATTATCTGATCCATTGAGCCACCAACA GTTGCAGTGTTCACTGCAGTATCAGTTAAACAATATCTAGGTATTTCACAAAAACTTTATCATAATATTTAAACACATAA GAAACATTCCTACGCCAAAATACTTATTAAATAAATATCAACATTTTAGGAAAACTATACGTTTCAAGCACAGTAGCAAC AATTTTTTATATCAATCCAAACATATCAGAAACAAACACATTAAAAACCAGGTAACAAAAACAACACAAAATCTTTATAA ATATATACAATCTTTTTATACAATCATTCCTACCTTCACCTAAACAGGTTCTCGTGCCAAATTTAGCAAATCGAATTCCT ACCAGCATCAACAATGACAACACAGACGGTAGAAGAGCAAATTAAAGAAAACATAAGAACAATCAACGATCTAAAAACAA TAGATCCAGAAACTCACCAAGTAAGTATTATTTACATAATCTTTTTCTCTTTTCTTTAATATTATTACTCAAACTAACAA ATTTCCTTTATCTATTAAGGGCACCAAATTCACAGTCAAAGCTACAATAACAGGATTTGCGACAGACAAAGGATGGTATT ATAATTCCTACCCCATATGTTATAGACAACTAAAACAAACAAGTCATGGTTGGTGGTGTGATAGCCACGGTCACATAAAT ACAATGTCATCCCCGTGGTAAGAAAAATTATCAATAAATGATTAATATAATTTATTTATCAATATTGATCACAATAAATA AATGACTATATTAATAGATTGCTATTATGCATATTATAGGTACAGATTAAATATAGAAATCACAAAGAATACCGGAAACA TGAACATCATGATATTTGGCAGAGCAACACAAGCACTGGTAAAAAAATCATGCTCTACAATAACAATTGATGAAGGCTTT ACTGATCCATCTATAATACCACCACAAATCAATCAACTAAGAGGGCAAATAAAGATATTCCAAATTTATTTTCAACAAAG AGCAACACAAGTATCTGCAAGTGCTTCTAAAACATTTGAAGATCCCAGACCCTCATTGCTACCACCAAAACCTCTGACAA CACCAGTAATAGAGCCAAAAACACCTGATCCAAAAAAATTAACCATCAGGTACGACATATTTATACAACTGTATCAATAA CCTATTAATATCATAACTTAACCTTCTAAACAAACATCTAAGCAATTCATTATTGCTGCATTTTTGAACCAAAAACAACA GAGCCATCTAGAAAATGCACAAGAACCAGGTAATATTACTATTTCTAAATCTTTCATTTTAACTTTTCTAATAATTGTAA TAATTTTTTCAAAAATTTCTATTTTGCAGCTCTAGTTCTAAACAACCAGCAAAAAATGTAATATAATGTACATGCCTTTT TACTAGACCTTTCAATATATATATATATATATATATATATGCGTATGTATGTGTCTCAAGCTATTTGTATGAACCTAGAT CTTTAAATAAATATATATATATGTACTTATGTTTATAAATATAAAATAATACTACAATGTAAAAACTCTTAACCTCTTCC ATAATATAACAGGCTTCTGCAGCAACACGCGGGAAAAAATACTAG