>DHH_5_1_Mno length=18577;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTAAATATACTATATATAAAAATTTATAAAGATTATGTATTTATCTTGCATATTATTGGTATAAAAATTCAAAGTTTAC TTAACTTATATGATATTATGAGTTTAAAACCTATCCAATTATAAATAAAATTGTATAATTGAACAAATTGGTATTTTAAT GACGAGATCATTATGATATAACTATAATTTGTCAGCAATATTTATCCTTCATATAACGTGGCCATTAGTGTAATAATCGT GCATTAGTTTAAAGTTTTCATTTATGCAAAGATCGAAGAAAAGTGTGTAGTTTTAAACTGGAGTGTAATTACCTCTATAT TTTTTTTATTTTTTTTTGCATGCACCTTCACACTTGGTTCTAGGTTCTAATATAGCTACGTGAAAACAAAAGGTGAAAGT TTAGAGTCCAACAAAAAATGCCCGAACTCGATTGGATTAGATAATATACTAGTTATTAGATTAGATTGGATTGGATAAGA TAATATACTAATTATTAGATTTGATTGGATTGGCTTAGATGAAATTCTTAAAAAGCAAGCGTTGATTGGATTGGATGTTA TATAGCTAAAAAATAGGGGTTAACAAAAAAACCTGAGGAACCCGATTAACCCACCCAACCCAATCAAACTCATTTTAACC CGAACCCGACCAACCCGATCAAGAGTTCAACCCAACCCGACTTTTAATTGGGTAGGTTTGGGTTGAGTTTTTCTTAACCC AAATTAACCCGAACCCGCCCAATTTATTTATCTATATAAATAAATATTTTCCTACCTCATAATATATAGTTTTTTCTCAT ATTTTACATTATTTACTTGACAATCTATTATGTTTTACGTTGTATAAGTTTTTATTATTGTTTCTTTGTTGGTTTACAAC TTATATATTTGAATTTATTTTGTATATATTTTATTTTTATATTGGTTTGTAGCTTATGTGATAATTTTAGAGCTTTATAA GGCTAATATTATGATGAAAAATAGCTTTCTTTTTATACATTTCTTATTTTGAGTTGAATGATTAGCTTTATTTATTTTTT TTATTTTTTATTTCTTTATTATGTTCAACTCGATCAACCCACCCAAATTCTAATTGGGTGGGTTGATTTTTAAACTTTGG GTTGATTTTGTGGGTTAAATTTGATATCAACCCATCCAAATTTAATTTGGTAGGTTGAAAAATCTTAAAAACTCACCCAA CCCACCTGATGTTCACCCCTACTAAAAAAAGTTTAGATTGGATTGGACGCACCTACTATGTTCTCCATGGGACTCTATGC CAAGCATTGTCAAACTAAGGTTGTAAATAATAAAAAATTTTAGGGTCTAACTTGTAAATTATGAAAAGTTGAGGGAGATG AGTGCAATTTACCATATTAGGCCAAACAAAACCAAACAACTCCCAAAGTTGGTGCTGGAAGTTTTCATTTTTTGACCTTT CTTCACATGTCAATTCGTCATTGTTACTTATAAAAGAAAAAAAAAAATCGTCATTTTTACTTCTCTTACTATCTCAAGCA AGGCATAAACCACATATGATGCTTCTGCAATACTACTACTCCTTGACCCACAACTTGCGGTTTCCATATGGGATCACTCA ACATATATATATTTATATATATATATATATACATTTTTTTTCTTTAAATCACACAACATATATAGTAAGCAATCCTATTT GTTAATTATTCAAATCTCTGCATACTATATATAATTGGCATGTGATCCTGAGACAGCTAATATTCTTATTAAAAGAAAAA TCATACATATCTCTGCTAGGATAATCCATTATTTTAAGTATGCTCAAAGGCACAACATGATATTAAAATGTTTACACCTT CTATCAGACCTTTTAACTTTTAAGTTTTAATGGTAAGGTGATGAACTTTGTTAAGAATAAAGGACGAAATGTAGTAACAC AAATTTTTCCGATGTCACTAATTCAACTCAGTCTATTTTCTTAATAAATGAATTAACCCAAAATTGAGGAACAATTGAAG ACATGAAAGAAAATGTAGACAACCGAAAATTGATGAGCAATTAAAGGCATAAATAAAATGTAGATCCTTGAGTTTTTAAG TGAGTAATTGTTTGCTCGTAAATATAACTTTACGTTAAAATTCATACAAAATAACACATGTCCGTGAGTGGCCTACTCCT CAAAGACAAGAGTTAAAAACTAAGCTCATAAAAAAATAAAAAATAAAAATAAAAAAATATGAGAGAGACCCTAAGGCTCA CGGTGACAGGGTATTTCGTAGGAAGGAATTGCGGGTGGAACTTGGTTATGAGCAAGGGTCTCTCTTCCCTTACCCACTAG CCGATAAAATAGGGTCGTTTCGTTTAAAATTAGATGACGCTTTTTAATCTTAAAATCCGTTTGGTTTATGAATTAGAATC ATGTGATTAGAACCATTTTTTATTTACGTGTATTTTTTATGAGAGAAAATACTGTAGCGAATCACGAATCATGATTCGAA TCAGGAACGAATCTCTCTACCAAACATCACCTTAACCACATTATACATACTACTAAAGGAGGCACCCGGGTTACTGTTCT TAGAACAGTGCCCGGTCCTTTTTATACTTATTTTTTGGAACAATTCCGGCTGTGTCCTAAAATTTGTTGTGATTGTTCGA TTTTATCCTCGGTTTTAATTTGTTGCAGTTGATATTGTTTTGGGTTTTTGGTAAATTTATGCAGAGAGAGAGAAAGTGCA TGTGAGATGTTTGAGTGGTGGGGCCCAGTTTCTGCAGAGAGAGAGTGGTGGGACCACAATTTGTTTTTACTATTTTGCCC TTAAATTTTTTTCCTTCCCGTGTTTTTCTGCTGGGCATTTTTGTCATTTGTTGCGGTGGGTTTTGTTTAGTCTCCTCGAG ATTCTTCTTGCTTCTTTCATTTGTTTCATGCCTCATTTCTCTTTTACCGAGGCTCATTTCCTTCGTTTCCTGTGCGGTGG TTTTTGTTTAGTTTTCTTGAGAAGCTTATTGCTTCTTTCATTTTTGATTCTACGCTTGCATCTAATGTCTCTTTTACCGA GGCTCTTCTTCTTCGTTTTCTCTTCACAAGTTCTCTTCGTTTTCTTTGTGGTTTTCTCTGGTTCATTGTATTTTGGTTCT AAGTTTTTTTTTTTTTTCCATTTTTTGTTTCTGGATTTTGTTGCGCTTTTCGTAAGGTTAATTTTAGATTTTTTTTTTTT TGACAAATGGGTTAAGGTTTTCGTGGGTTTCATTTTGGTTTCTTTTCTCTGTTTTATGCATTTTTTCCTTTTCTTTCTTT CTTTCTCTTCGTAAGACTTCTGGGAATCATTGTTAATGTTTGTTTTGCTTTGTAGTTTTGTTTTTCGTTTTTTTTTTTAT TTGGCTTCCTTTTTTTATTTTTTGATTCATTTTTTTTCGGTTTATTTTTTTAGATCACCCCGTTTATTTTTCCAGATCTG TTATTGTTTTTGTAGATTTGGCTTCCTTTTTTTTCATTTTTTTATTAGGTTTTTCTTTTTTGTTTTTTTAGATCTGGACA TGTTTTTGCTTTCTTTTGTTCCCTGTTTTTAATTTTTTTTTATTTTATGTTTCTGGGTTTCCTTGCGTTTTTCGTGGGGT TATTTTCAGATATTTTTTTTTATTTTTTTTCACAAATGGGTTAAGGTTTTCGTTGGGTTCATTTTGGTTTTTTTCTCCTG TTTTATGAATTTTTTTCTCTTCTTTCTTTGTTTCTTTTCATAAGGCTTCTGGCAATCATTTTTAGTGTTTGTTTTGTTTT GTAGTTTTGTTTTTCGTTTTTCTTTTCTTAGATCTGGCTTCGTTTTTATTTTTTTTATTTGCTTTTTTCTTCCGTATATA TTGTCAGCTCTGTTAGTGTTTTTGTAGATTTGACTTCATTTTTTCCCGTTTTTCCTATTCGGTTTTTCTTTTTCATTCTT TTAGATCTGTATGTGTTTTTGCTTCATTTTGTTCTGTGTTTTTTAATTTTTTTTTCATTTTTCTAGATCTATTAGTATTT TTGTAGATTTAGCTTTGTTTTTTTATTTCAGTTATTTCTTCATTAGGTCTTCGGAATAATCAATTTTTACTTTTTCCTTT TTTTCTATTTTCGTCAATTTTTATTCATTTATTGATTATTACGTTGTCTAACACTTGTTTTTACTAATTATTATATGTTT TTATATTTGTTTGCAGGTTATATTAGTTGGGAAAGACATTTGTTTGTAGTGCAGGGTAACTCTTTTTAACGAGTTATTCT TTCTCACTATCTACAGGTTTTTCATTCTATTCCATGGTAATTATCATGAAGCGTAACACCTATTTTTAACAAATTATTAC GTTTTTTTTTCACTCTCTGCAGGTTCTTCGTTGTGTTCCACGGTAGTTATCATGCAACGTAACACCTGTTTTTAACAAAT TATTACGTTTTGTTTACAGCGTAACAACGATGATGTTAAGTTTTGTTTCCAATATATACCACCGCAACATACTCGAAAGT TTATTTTTTCCCTATAAATATATTGTTTCCCCTTTCACATTCATTGTCTTCTGCTTTGTTTCTGTTTTCGTTATGATACA CTTATCGTCTATCCTCTATGTTTCTTTTCTTTTCTTCAATTTTTAATAGTTAGTTTTTTTTCTCTCCTTTTTCTGTTATC TCTATTTTGGAGTTTTTTTACTCCTCCTGCATCAACTCTATCCACTTTCATCGTTATTCTAAGGTACTCTTCTCTTACTT CTTCCATATCATTTCTAATTGTTTTTAAAATTGTATCTATTATATTATTATACTTTTGTTACTGTATATATTGAATTGTA AATATATGTGTTCATTGTTTTATGTTCTTATGATTATATTTGTACTAATTCTATTTATTATATTAATTTGTCTAACACTT TGTTCTATATCTAACATGATTTCTCATTTGATAATGATGTAGTATTTTTCTTTTATTGTTACCATGTATTAAATAATTGT TTATAATGAATTAGCAAGCCTTGATGTTGCCCGGATTATTTAAGATTTATATTCTTTTATTTATTTGGTTTTGTCAACAG TATATTATTTTTATTATCATTTTCTACTCTTAAAATGATTTGTTCTTCATCTGATTTTGCTGAAGGGTTTTCATTCTATT TCTTTACTACTGTCTCTATTGTTGGTTTGCCAATTTAAGTTATTTTTATGTCAATTTTTTTTTCATTTCTTTTTCCTTTC TTAATATTTATAAATCTTTTTAATAATTCAATTGGCACTGAAGGGCATTGTTAAATCTTATTCTAGTTACTTCTAATGCG TGATATTAGCAATTAAAAATAAATACCTGAACCAAATTGTTTATATTTATCTATTTAATTTCCTCATCTATTTTTTTAAA CTAATATTTATACAATTGACTATTTTAAATAAGATTTTTGATATTTTATCTTTCTTATTTTTTTCCCATTCTATGTTCTC CTTAATTTGTCACTACAATATATGTTGCCTTCCTGCTGCCATTGTTAATGTTAAAAAGAAACTCTTTAAGTTTTCATTTT TAGTTTCTCAATATTTTCTTCAGTATTTTCACATTTTTCTTCTCTTGAATTGTTGCAGTCACTCTTTAGGAAAGAGTTGT TTCAAAGAATTGTCTTTCTTCTAAGGTATTTTTTTCTTAATTCTATCATGTTATTTCTGAGTGTTCTTAAAATTTTATGT ATTATATTACTATGCTTTGTTAAGTATTTATATTAAGTTACACTGTTTTATATAATTATAATTATATTTGTAATAAGTTT GTTAATATTATTTGTAAAACATTATTTAGTGTTTATATTACATAACTTATTGTTATTTGACTAAAAGTTAGATTTCCTTT ATATCTCTTATATTAATCTGTTAACATTTTCTTTTGATGCAGAGGACAATTTTTATGTAACATTTATAAAAATATCTTCA TCTAATTTTACTGAAGAATTTTTCTTCTACTGTTTTTATCACTACCTCTATTCTTGGTTCGTCAATTGAACCCATTTATT TGTTTATGGAACATTTCGATAGATTTAGTTCCAATCACACGGTTGTAAATATTCTTTTATGTTTTTTATATTTGTATTAT TTATGTTATCTAATCTTTTTTATGTTTTTAGTACAAATTCTATAATAATTTAATTAGTATATGTTATTAGCAGTAAAATA TAAATACTAAACTATTATTTAATTTTGTTAAACGGACAATTTTCATTTTAGTCCTTAAATGTTGCTTCTGTTATTAATTC ATCAACTGAACGTATACCTTTGCAGTATTCCTTACTTTTTTCCTACGTTTTTTATCTTCCTAAATAATATCTAAACAAAA TAACATTTAAAGTTTTATTTTTAAGACATTTATACGAAAACATTGTTTACGTCTTTCTAAACAATATCTAAACAATATAA CATTTAAAATTTCATTTCCAAAACATTTTTACAAAAACAGTGTAAACAATATGTAAACAATGTATGTTATTCTCATACAA TATACAACATTAAATTTTATATACAAAAGTATAATTAAAAAAGTATAAATATATACAATATTTGAATGTTAACGTGAATC TATTGTAAATAATATTATTTTTTTTTGTTTTTTATAATTCACAACTTTAATATATATGTACTAATTAATAATACACATTT TTAATATATTGTGCTTATTTGAAATAGATTTATTGTTTCGTTTCAGTTTCTACCGTTGACTACAAATTTGAATAGTATTT GTGTATGCCTGACACTCGAGTTGTGCTTAATTCTCTCAAATACAAACGTGAGCTCTATAATGACCGAGATAAATTTTAAA TGTTTTATTTATACACTGTTAATATTTTATATTTGTTTAAAATAAATTTATTAACATATATAACAGATTAAAAATAAATT ATTTATATTTAACTTATTATATATATTTAACAAGTTTTTTAAAGATTTATAAAAAAATTTTAACGTTAATTTTCAAAAAG TATTTCATTTTATCTAATGATAAAATATTTATATAAATTTTATATAAATCGATTATTTTCGTTAATAATGTAATACATAT TTGTTTATACTTCTTTTGTAGTATTAATTATATTATATCTATTTATTAATATAAAATTATTTTTTAATTATAAAATGCTT ATACCATTTAATTTTTTTGTCTATTATAATTTAAAAACCAAAAAAAAAAAATTGTAATTCTTTATTATATATTTCTTCTA AATATATCTTCACACTACCTTCATTTATTTTATCATTTGTTATATCTATTATTTCTTCTTTTCTATTAATTTAAATATAT GTTTAGATAAATATTTGTTAACTATAGAACATAAACATATTACAGTGTTGATTACATTAAAATTTTAATAAATATATTTG TATCAACACTTTAAAAAAAATCTCTAATGTCTTCCATTATAATTGAGCATAAAACACTTAAATATATATTAAAATAATAA ACTAATGTTTAAAATTTAAATTTTATTAATAATTTTACTAACTAATAAACTTTTTATTGTATTAAAATTGTTTTAAATAT AATTTACAGATAATAAAAATGAAAAGAAAGTTCAACCGAAATTTTCTCCATCAAAAAACTACGAAAAGTGTCAAAAACAA AAAAAGGAGGACGACCGAAATGCATCAGTCAAATTCGGAAAACATAAGGACACGTCGAACCAAACATACATAGTTTTGTG GAACTTTCATCAATACTCAGATCCCTTTAGAACCAACAATTCAACAGTCAAATACAACGTTGGTTGAAGAAAGTAATTCC TAAACTTAAAATCTTTGTCTCTAAATTGTTAACACCTCTATTTGTAACTAATTTAAAATTATCTATGAAATTAGGTGATC TAAATGCGTATATTGATCTTGGAGATTGTGACTCAACATGTGAACATTGTGGAGCAATATTTTAGAATAATGAACGAACA AAAAAATATTCATATAAATATTCTTCATGTTGTCAGAATGGAAAAATAAAATTACCTTCTAAAAGAAAAACAGCATTGAT TTTAGATGAATTATTAAAATATTATTGTGGAAATCTAAGTACACATTTTAAGAAAAATATAAGAATGTATAGTTCAATGT TTTCTTTTATATCATTTGGGGCAAACATTCAATCAAATATTAATGAAACGTTGGGACCTTATATATTCAAGATTAGTGGT CAGACACATCATTTAATGGGATCTTTACTTCCAGTTGATAACAATCCTCCAAAATTTGCACAATTATATATTTATGATAC AAAAAATGAAATTCAAAATAGAATGTCAATATTTACATCAACGAATACTTCAGATTCTTTAAATGAAAATATTATTGATA ACAATGTTAGATGAAAGAAATATATTACTTAAATTATTTAGATTTGTTAAAAAATTTTATAACACTGACAAAACCCAGTC AATGCAATTAAGATTAATAGGTAGACGAGAAGGGGATGGTACACAATATGACCTTCCAACTTCAACAGATATAGGAACTT TAATTGTTGGTGATATTGGTGAATACGAAAAAGGAATATATACTATTATATGTAGTCAAACAGGTGACTTACAGAGAATT AATAAACTTCATCCATCTTACATGTCATTACAATATCCTTTATTATTTCCATATGGTGAAGATGGATAGAAACCTAATAT AGGATGGAATCCTAATTTTGTAGGGACAAAACCATCTAAAAAATGAATTTCAATGAGATCATTTTATGCTTTTCAATTAC AACAACATTTAAATGAAAGAAATACATTGTTTAAAAGTAGTAGACTATTTCAACAATATATTACAGATGCCTATGCTACT GTTGAAGAAGATTGATTCGACTTTATTAGACAAAACCAAAATAATTTGATATCTGAATTTTATAAGGGTATTCAAGATGC CATAACTAAAGGTGATACTGACCCTCAAACAATTGGAAAAAGAATTATTTTACCATCATCTCATACTGGAAGTCCAAGAT ATATGATTCAAAACTATCAAGATGCAATGACAATATGTAGACGTTATGGAAATCCTGATATTTTTTAACATTTACATGCA ATCCTAAATGGCCTGAAATTATAAGAGCTCTAGCTGTACTTTCGGGACAAAAATCTAATGATAGACCAGATATCATAAGT AGAATTTTTAAAATAAAATTAGATCATTTATTACATACAATAAAATATGGATAAATATTTGGGACCATAATAGCAGGTAA ATTATTTTATTTTACCCTAAACTTTTATATTCAATTCTGTTATTGCTTAAAAAAATTTACATTTCTTTAAAATATGTTTC TAACTCTTTTTATGTCAATATTTTTTCTATTATTATAGATTTATACGTTGTCGAATTTCAAAAACGTGGTTTACCTCATT GTCATATGTTATTTTGGTTACATACAGAAAATAAATGTCGAGATCCAATATAGATAAATAAAATTATATCAGCAGAAATC CCAAATCCAGAATATGACCCATTAGGTTATAAAGTTGTTACTAATTTTATGATACATGGCCCGTGTGGATATGCAAAAAC AAATGCTCCATGTATGAAAAATTCAACATGCACTAAAAAATTTCCAAAACAATATAAAAATGAAACAAGCATAAAAGAAA ATGGTTTTGTTAGTTACCGAGTAAAGAATCTACTTTTAATACTATTAAAGAAGGAATCCAACTTGATAACATATTTGTTG TTTCATATAATCGTACATTATGTATAAAATATCAAGCTCACATAAATGTTGAAATATGCTTTCAGTCAATGCTCATAAAA TACTTATTTAAATATTTAACAAAAGGACCAGACAGAATAAGAGCTGCTATTGAAAATATAAACATTACAGATACTACAAA AGAAACAAATACAGAAGAAATTGATGAAATAAAAACATATCTTAATTGTCAATATATTACACCCTATGAGGCAATTTGGA GATTATTTGAAAACCCAATACATCATAGAAATCCAGCTATTCAATGACTTACAATTCATCTACCAAACATGCAAAACATT ACATTTAATAAGAATCAACAATTACAAAATATAATTAATTTACCACACAACAAAAAAACAGCACTGCCTGAATGGATGGA AATTAATAAGACACATGAAGAAGCTCGACAACTTACTTATATAGAATTTCCAACAAAATGGGTTTGGAAACACAAATATA GAATTTGGACAAAACGAAAAATTGGACACACTATTGGAAGAATGTTTCATATTCCTCCCAATTCGGGCGAATTATTTTAT TTAAAATTATTATTAAACCATAAAAAAGGTGTAATAAGTTTTGAATCAATTTGAACAATTAATAATATTATTTATCCAAC TTATCAACAAGCATGTCATGCATTAGGTTTATTATGAGATGATAAAGAATGGAATGACTCAATTGAAGAAGCATCATTTT GGTCAACATCTATTCAACTTCGTCAACTTTTTACTATTATTTTATTATTTTACAATGTATCTCATCCAATTAAATTATTA GAAAATCACTGGAACCTAATGTGTGATGATATTATATATAAAATAAAAAAATTTATTCAACAATTCAAAATTTTAAATTC CAGAAAATGAATTATACAATTTTGTATTATATGATTTAGAAAAATTATTAAATTTAAATTCATCTTCTTTAACAAATTTT AACATACCACTTCCAACAGGATCATTAATTGAAGATTTAGATAATAAGCTTATAAGAGAATAACTAAATTATGATAAAAA AAATTTAAAAAAGAAAATATAAATTTAATAAATAATTTAAATCATGAACAATATTACATTTACAATGAAATTTTAAAATC ACTTAAAAACAACAACAATAACTTATTTTTCATATATGGATATGGAGGTACAGGAAAAACATATTTATGGAACACACTTA TTAACAAAATTAGATTAGAAGGTGAAATAGTATTAGCAGTTGCATCATCTGGAATAGCATCATTACTTTTACCAAACAGT CGTACTGCACATTCACGGTTTCGTATCCCTCTTTTAGTTGATAAATTTTCAACATGTCAAATTAAAAAAAAAANNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNCTTTCCCTAAAAAAAACGTGAACCGTCTTTTTACATCCCCAAAAGGTTTAAATATATTAATACACGAATCA ATAAACAAATATCCAAATTATATAAAAAATATTGTATATAAAGAAATATTACATAATATTAATAAAAATCAATCTACTTA TTCTTTTTTACATTATAATAAAATAATTAAATCAATATATGAAATGTCATTTTTACTAACTTTATTTTAACAGTGTCAAT TTCTCACAATATTATCATTATTTTCTAATGTATATAAACTCACAACATTCTACAATATCATGTTCTAATTTTTAAAGTAT TATTGTAAATTTTTATAATATAATATTCTTTTCCATTTATATATTATAAATTTTAATATCTTTTATATTATTCTACAGTT TCAACAAAATGTTTGCACCAATAAGAATCCTGAAACCTGGTGAAACACACTTGACTATTCGTGCTCGAATATGTCGTTTA TAGAAAAACGTAGATTACAAGACAGGAGAACTTTTCAGTCTTGATATACAGTTGGTTGATGAAGAGGTAATGTAATCTAC TCTTTTTATGTATTACATGATTAAACATAAATAACAATCGGATATATTTGTTACTCGATATATAACAATAAAAAATCTGT TTTATAATTTTACAGCATGAAGCAATACATGCAGCTATTTGATCAAGAGATGCTGACTACATGAGCCAAATAATTGAAGA AGGCAATATAGATGAAATTAATAACTTCTTCATCGATCGGAACAAACCAAGATATAAAATTGTTCCCCATGTGGCAATGT TGCGGATTGCTAGAGCAACAATTTTTAAACATGTTCCTGAAGACATGCCTGAAATACCTCGACAAAAATTTAATTTTGTC GAATTCGATCTAATTTCTCAAAGAATCGACGTAAACAACGTTCTCTCAGGTTTGTTTATTTTATTACCTATTTATTTATA ATTTTTAATCAATTATTTCTCATTTTATAATAGTTAAAACTAATTGATTATACATATAATATTTCTATAAGATGTAATAG GTCGACTTACATCCTTCCATGGTATTGAAGAATCAGCCATCGGTGAAAGAATTGACAAAAGAAGAAGTTTCACAATTCAA AACATAAGGTAAATACAATAGAAACTATTATTACTATAATCAAATAAAAAATTTTATTCATATTTAAATATTTATAATTA TGTTTTCCACTGTTTAATACAGAGAAGAACAATTGAATATAACACTTTGGGGAGAAATAGGAGAGCTTTTTGATGAAAAT GTTGTGCGGTCAATGACAGAACCAATTGTTATTGCTTTTACAGCAATGGCAGCCAAACAGTACCACGGTTATTATTTATG TTACAATATATTCTTTTAATTTCTTATACAACTAACTATACATTTTTATTTATTACAGGAGGTCTTTACTTATCAGACAT GTCTGATACTTTTTACTTCTTGGATCCAGAAATACCAGAAACACGGAAAATTAAACAAAGGTATAACAAAAAATACTAAC TTTTTACTATTGACATATATGCATTTTCTCATTTTTATTTATTCATATAAACATAAATACTTTCATACAGATTCCGTCAT TCCATTCAGAGTCCAACAAGACTAGCAATATCATTAGAAGACCAAAAGATCGCAAATCGTATCACCATCGCAGAATTACG AGCATTAAATCCATTCCAAAATCGGGTATAAACTTTATCAATACAATTCATTAAATATAATATATATATATATATATTGA ATTAAAATGTTTCTTTCTCTACTTAATAGGAAACAAAATACACAGTTAGAGCAACTATGACTTATCTGAATACATATCAA GGATGGTTCTATTATGTCTGCACAAAGTGTTACAGACAAGTGCAAGAATCTGGAACATCATGGTGGTGTGATACTGACGG ATATCTATATACAATGCCATTAACTTGGTAATAAATTATGTTACAAAAAATAAACAAATTAATTTTTAATTAACAAATAT AATAAATATATTTGATTTTTTTTACACAGGTACAAAATAAATATACATATCGAAGATAGTACTGGAAGAACATACACTAT AATGTTTGGTAAAATAGTACAGTCACTTATTAACAAAGTTTGCTCTACACTTACTTACGATGAGGGATACACTGATCGTT ACATGATTCCTCCTATTTTAGAAGAAATAAGAGGAATATCAAAAATATTCGTCATACAGTTTCGAAGTCGATGAGCTTTT ATCGATAAAGTTATTTTGAAGACTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACCAATTGTTATTGCTTTTACAGCAATGGCAGCCAA ACAATACCAAGGTTATTATTTATGTTACAATATATTCTTTTAATTTCTTATACAACTAACTATACATTTTTATTTATTAC AGGAGGTCTTTACTTATCAAACACATATGCTACTTTTTACTTCTTAGATCCAGAAACACGGAAAATTAAACAAATGTATA ACAAAAAATACTAACTTTTTACTATTGACATATATGCATTTTCTCATTATTATTTATTCATATAAACATAAATATTTCCA TACAGATTCCGTCATTCCATTCAGAGCTTAGATTACATTGCTACACCAACAAGACTAGCAATATCATTAGAAGACCAAAA GATCGCAAATCGTATCACCATCGCAGAATTACGAGCATTAAATCCATTCCAAAATCGGGTATAAACTTTATCAATACAAT TCATTAAATATAATATATATATATATATATTGAATTAAAATGTTTATTTCTCTACTTAATAGGAAACAAAATACACAGTT AAAGCAACTATGACTTATCTGAATACATATCAAGGATGGTTCTATTATGCCTACACAAAGTACATATCAAGGATGGTTCT ATTATGTCTGCACAAAGTGTTACAGACAAGTGCAAGAATCTGGAACATCATGGTGGTGTGATACTGACGGATATCTATAT ACAATGCCATTAACTTGGTAATAAATTATGTTACAAAAAATAAACAAATTAATTTTTAATTAACAAATATAATAAATATA TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTTATTAACAAAGTTTGC TCTACACTTACTTACGATGAGGGATACACTGATCGTTACATGATTCCTCCTATTTTAGAAGAAATAAGAGGAATATCAAA AATATTCGTCATACAGTTTCGAAGTCGATGAGCTTTTATCGATAAAGTTATTTTGAAGACTTTCAATGACGATCAGCCTT AATTGTTCTTACCACCTACAACAACTGAATCTTCAAAAGAGGCAACATCAGTTTCAAAGCCAATTCACGCTATTTCAGTC CCTCACGAATCTACCTCTTTCGCAAGTTCATCAAAAAAAAGAAAGCAAATCAGGTAAAATTATATGTTATATATTATATT AAATATTTAAATTAATATGCACACAATTATTAACATTTATTACAATTTAATAATAACTATTTTATTATTTCCTTTTTTCT TAACTACAGCTCGGAAGAAACAACAAGCCAAAGCAAAAAGAAGTAGATATATGAATAAATCTGTGTATATCTGTAAATAA GTTTGTATATTTTTACTTAGAAAAATTGAGATATAAATAAATGTGTACATATGTGTTACAAATTTACAACAACTTATAAA CATATATATATGTGTGTGTTTTTATATAATTTTTAAATTTAAATTATTGTTAATTAAACTATTGCATATCCGTGCAAATG CACGGGTAATCCACTAG