>DHH_4_1_Mno length=18874;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATATATTATTAAAAATAAAAAAATATTTGGAACAATTATAGCAGGTTAGTTCATTCTATTCACATTTATTTCATCTT ATGAATAGTTAATACAAATAAATTATAATTTCTAATACAATAAAAAGTATAACAAATTATTTTTTAATTTTGTAGATTTG CATGTCATAGAGTTCCAGAAACGAGGTTTGCCACATTGTCATTTTCTCTTTTGGCTTCACAATGACGACAAAATGCGTGA ACCATGGCAAATAAATAAATTCATTTCTGCAGAAATACCTAATCCTAATAACAATCCATTAGAATACAAAATCGTAGCAG AATTTATGATGCATGGACCATGTGGCATAATTAGGCCAAATTCTCCATGCATGAAAAATTCAGAATGTTCAAAAAAGTTT TCGAAACAATTCAAAAATGAAACAACAATCGAAGAAACTGGATTCATTAATTATAGATGAAGAAATACATCATTTTATAT TGAAAAGGAAGGTATTAAATTAGATAACAGATATGTAGTTCCATACAATAAAGATTTATGTCTAAAATTTCATGCTCATA TCAATGTAGAAATTTGTTCGCAATCAATGCTCATAAAGTATTTATTTAAATATTTGACAAAAGGACCAGATAGAATTAGA GCAGTCATAGAAGACAATGTATCTATAGAAAATACCGGTCAAACCACTTATAGAGAAATAGATTAAATAAAAAACTATAT TAATTATAGATATATAGCACCATATGAAGCAATGTGGCGATTATATGAATTTCCAATACATCATAAAAATCCTGCTGTTC AAAGATTATCAATACATTTACCAAAAATGTAAAATATAACATTTCATTCAAATCAACGCCTACATAATATAATAAGACAG CCAGGTATTGATAAGACAACTCTTACCGAATGGATGGAGACAAATAAACACGATATCAATGCTAGAGATTTAACTTATAT AGAGTTCCCGACTAAATATGTTTGGAATAGCAAATATAAATATTGGTCTCAAAGACAAATAGGATATGCAATTGGACGAA CTTTCCATGTCCATCCAAGTTCCGGAGAATTATACTATCTAAAATTATTATTGAATCATCAAAAAAGAAAAATAAGTTAT GAAGACCTTCGAACAGTCAACAATATAAAATATCCAACAAATCAAGCTGCATGTTATGCATTAGGCTTACTAGGAGACGA TAAGGAATGTGATGAATCAATATTAGAAGCTTCATTTACATCAACAGCACCTCAACTGCGACAATTATTTGTTATAATTT TATTATTTTGCAATGTAAGTGATCCAATAAAATTCCTTCAAAAACATTGGAAACTTATGACAGATGATATTTTGCACAAA ATCAAGACCTTATTCAATAATCCAAATTTTCAAATTCCCAACAATGAATTATATAATTTTGTATTATACGAATTAGAAAA ATTATTAAATCTAAATTCATCAAGTTTAACACATTTTAATCTACCCCTTCCTACTGGATCATTAATAGACGATTTAAATA ACAAACTCTTAAGAGAAGAACTTAATTATGACATAAATAAATTAAAAGAAGAAAATACTAAATTAATACAAAACTTAAAT CAAGAACAACAATTTATTTACCAACAAATTTTAGAATCATTAAACCAACAAAAAGACAACCTTTGTTTTATTTATGGTCA TGGCGGAACTGGAAAAACATATCTATGGAATGCAATTATTACAAAAATTAGATCAAATAATGAAATAATTCTTGCTGTTG CATCGTCCGGAATAGCATCATTATTATTACCTAAAGGAAGAACTGCACATTCAAGATTTAGAATACCACTATCAACAGAC AAATTTTCTACCTGTCACATAAAAAAAGGAACACAATTAGCAAAATTAATTGAAAAAACATCGCTCATATTATGGGATGA AGCACCAATGACAAATAAATATTGTTTTGAAGCATTAGACAAAACACTTCAAGATTTAAGAAATAATTTCGAACAACCAT TTGGCAGAATGACAATTGTATTAGGAGGTGATTTTCGACAAATATTACCAGTTATTCCTACAGGAACAAAAGAATACATA ATAGATGCAACCATAAATAAATCTTACTTATGGCCACATTTTCGAGTTCTAACACTAACAGAAAATATGAGATTAAAACA CTATAACATCACAGAGGAAGAAAAAATGGAAATTGCAATATTTTTCAGATTGGATATTAAGCATTGGAACGGAACTGCAC AAGGAATAAAAGATCCAGAATATTGTTTTGAAGCATTAGACAAAACACTTCAAGATTTAAGAAATAATTTTGAACAACCA TTTGGCGGAATGACAGTTGTATTAGGAGGTGATTTTTGACAAATACTACCAGTTATTCCTACAGGAACAAAAGAGTACAT AATAGATGCAACCATAAATAAATCTTACTTATGGCCACATTTTTTAGTTCTAACACTAACAGAAAATATGAGATTAAAAC ACTATAACATCACAGAGGAAGAAAAAATGGAAATTGCAATATTTTCAGATTGGATATTAAGCATTGGAAACGGAACTGCA CAAGGAATAAAAGATCCAGAAAATGAAGACGCTACATGGATAAAAATACCAGACAAATACATATTACACTATCAATCAAA TCCAATTGAAAAAACGTCTACATTAATATATAATGATTTCAATAATTGTTTTAACAATATTGAATATTTAAAACATCGAG AAATAATAACTCCAAAAAATAAAACAGCTGATAATATTAACAATTACATATTATCCTTAGTTCTTGGAGAATTAAAATCC TATTATAGTTATGACACAATTGCATCCTCATCCGAAAATATAGATGAACTTAACTTATTATACCCTGAAGAACTCTTACA CAGTCTAAATTTTAATGGAATACCACCACATCAATTAAATCTTAAAATAGGAATTCCAATAATGTTGTTAAGAAATTTAA ATCAATCTATTGGATTATGTAATGGCACAAGACTTATTATCACACAATTAACAAACAAAATTATAGAAGGACAGATCATA AACTCAAATAATATAGATGAAAAAGTTTATATTCCAAGAATAGAAATGAGTGTACATGAATTTAAATGGTCATTTACATT AAAAAGACGACAATTTCCAGTAAAAATATGTTATGCAATGACAATAAATAAAAGTCAAGGCCAATCATTAGCTAAAATTG GATTATATCTAGAAACTGAAATTTTTACTCATGGACAATTATATATTGCTTTATCACGAGCGACAAATCCTAAAGGATTA CACATATTAATACATGATTTAATCAATAAATATCCAAATCATATAAAAAATATAGTCTACTAAGAAATTCTACACAATAT TACATAAAAACATAAAATATTGCCAAAAAACTATACCAATATTATATTAATAATTTTATTACATTTAAATCCCTTATTAT TATTAAATTGACAACATATATTGCATGAGATTATTGATCCAAATAATTATTATCCCTTCACAAAATATAAGCAAAATAAT TACACAACTTCATACATTAAAATCAAATAAAATTTATCAAACTATTAGAACCAAAATTTGTAAATTATAGACAAACAATA AATTAATAATAAAATATTTAATAAATCTACACTGCTTTTTGGTCAATAACCAGGTAATAACCTTTGCAAACATTATACTA CATTATTTTAAATTTAATATTGAATATTATAAAATAAATAACAATCTTATCTTCCCTTTTGTACTATAGAACAATCCAAG TATCCACTAAAATATCTGATTCAAATGTTATCGACAACTAAAACAACTTGGGATTGGTTAGTGGTGTGACAGTCACGGAC ACATAAAAACAACACCATCTCCATGGTACAAAAAATTCCAAATATACTATTGCCAAAATCAATTTATTTTTATTACTTAT AATAATTAATCTATTACATAAATAAACTATAACTTTACATATTACAGGTACAAATTAACAACAGAAATCGAAAATGCAAC TAGAAACATAAACATTACTATATTTGGCAAAGCAACACAAACACTAATAAAAAAACCATGCTCTACACTAACAATCGATG AAGGCTTTACTAATCCATTTACAATCCCACCAATCATCTCTCAACTAAGAGGACAAACAAAGATTTTCTAACTATACTTG TAGTGACCAAGAAAATCTCAGAATTTTAATAATGTAATTCATGTATTTGAGTCAAGGATTTTCCTGGAAAATCATTATAC TATGTACATTTTGTGATTGAAGGATTTATGGAATTAACATCTGCATTCCTAAATTCTGTAGCAGATTTCACGTTAAGTTC ACAATTTTTCGATCAAGTAATTTCGATCGATAAATTCTCACCGTACTTTAAAACGGAAGAATTTCTAGTACAGATACAGC TTGAGAACCTTAATTTTAAGAATTTCCAAGCACAATACAAACTAGCATCCAGTACCCGCATACAGGAGAAAATAGCTGTC AGTATAATTTTGGACAGTTTAATGAGTAAATTTAGAAAGTAGACAAAGGTACAAGGGTTAGGTTTCATTTTTCTCTTTCC TTCCTTCACTTGGCCGGCCAAACTTAAGGGATTATGGCCAAAAATTTGGCTAGTGAAGTGTGCTACATGGACTTCATGAT GGGATTGAGTCAAATCAACTATTGGACATGAAATGCTACATCACCCCTCTTGAAACCCCCCCCCGGCCAGCCACAATAAA GGGGGGGATTAATCCAAAAATCTAGCTAATTAAGCTAGTTTGGTAGACTTAAATGAGAACTAAGATGAGATCAAGTAATG TCTATAAAGGTGAGACCATTAGTGCAAGCATTAGGTTAGCCATTTTGCACATCTCCTCTCATTTTCCCCCACACCCAAAC CGGCCACACTCCTCCATTTTCCCCTCAAATATTTTCTCCTACTCTCTCAATCTTGAGCCACTACAAACCATAGAAGAAGA AGAAGGAGATCAAAGGGTCTAGGAGGAGTCTAGACAAGCATTTTTTTCAAAGGGTATAACTCTAAATCCTTTTTTTATGT TTTAGTAAAGTTTGAAATGTAGAAATATTCCTCTTAAATTTCCTTATACTTTCTAGTTCAAAGCCAATAACAAATCTTAG AGGAGTTCAAGGTTTTTCAAGGGAGAGAGAGAGTTCTTCAAGGGTAAGTTCCTCAAACTCTTCTCCATTTATTTCTAGCC AACTTTGAGCTTGGATTTGTGGATGTAAATTTGAGGTTCTTGAGGAGATGAGTTGTAATAAGGGTGTGTGAGTTTTATGT TGGTTTTGTGAGTTTTGAGGTTAGCTTGATGTGGTATGTTTATGCTTGATTTAAGTTGCTTATTTTCNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCTCGCCTACAG TATAAATAGATTTTAAAGTAAACAGTACACATGAACTATATATGTTTGAGTACATTTAATGTTATGAATGCTATGCTATG TTATACTACATACACTTAGGCAGTACACCCGAATTATATGTGTTCGAGTACATGATATAGTATGTTATACTAGGTCATAT TGCATACACCTTAATAAGTCAAGAGGAACTTATAAGAGTAATCTCAGTTGAGTGCCATACCAGCCTCCACAAGGGAGGTA ACTCAAGCTCCACAAGGGAGAAAAATAATAATAATAATGATGTCCTCCGACTCAAGGGAGGCATTCAAGTTATAATCACG GTGTCATGGGGGACCTTGCAAACCCTCACGTCCCGATGATTGCGCGCAAGTGGTACGAGCACTCGGGCCCATCAGTAAGA AAGATAAGATAAGATAATAAGATTCTGATAAGACATCATAATTAAGCATAATTGGCTCATGCATATTTATTCATGTGAAC TTACAGTTATTTTGCGGGAGATAGTTCCTACTTGCTGAGCGAAAGCTCATTATAGAATGTTTATACTGTAGGTAAGCAAC CGGCATATAATGCCTGATGGACTGCTGGCGAGTGGACGAACGATGTGGGGCTCGGGATATGGATACCACTCGCAAATATT TCCGCAATCAGCTTTATGTTACAAATAGTTTTGTTAATTATGATTATGAAACAGATATGTTAAGGTTTGAATATTTTAAT TAAGAAAGCAATTTCGTATTTTATGTTTATTATAAGACCTTTCAAAAAAAAAAAAGTGTTCCGTAAATTTTAAGAAATTT CAGTAAGTACAAGTTAAAAAGTTAGTTACAGTGACGGCCTCAAAGGAGGGTCGCTACAATACTTTCAACAAAGAGGACCA CAAATAAATGCAATCGTTTCCAAAATATTTGAAGACACAAAGCCTCTAGCACTACCAATACCAACATCAACAACTATAGT GACAACGACAAGGTAAAATACTTATATTAAATTGTACCTATTACAAATAAAAAAATAATATCTAACATCTAAACTATATT TTACCATTTCAGCTCTCAAACAAAGACAATAGCAACAACTCAGACACCAGTGGATCCACAAACTCCAGACCCAAAGAAAT CAACCGTTCGGTAAGTCATAAACTAATATTCATTATTCATAAATCAAACACAATATTTATAATTTTATATATATATCTAA ACAAACTCTCATCATTGCAGTTCACGATCAAAAGAACCAGAACAATCTACAAAGCGGCCGAGGACCAGGTAATATCACTT CCTTTAAATCAAAATATTATCAATTTCATCCATTATCAATACTAACTTTTCAAAATTATACATATTATAGGTGAACAAAA AAAACAAGGCACCACAACGACAACAAAAATCTCAATCACAATGTAAATACATATTTAATAAAACATTATATAAACATGTT CAAATATCTATATATATATATATATAAACTGCTTTTGTATTGTAAAAACTATCAAGCTCTTATATAACATAAAACTTTTT AGCTACTTCTCCCTTCCTGCAAAAAAAAAAATTTTCCAATCACTTTAATCTAACAATCATCTTTTAACACTTTATCTTTA ACCTTTATCATACTCAAAATATGTTTACATGCTATAAAATTGCTACCCGTTGCAACGCACGGGTATTTCACTAG