>DHH_3_1_Mno length=21176;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTTGTATTATATTAAATATAATAATAAATATATAATGCAATTATATATACTACATTATAGTATAATCTAATCTAATCGT AATTTTTAATTATTTCAGTTATTATTTTAATAATATTATTATAATTGATATCATAATTATATAATATATTATGTAATAAT AGTTTTTTTATTATATTAAATATAATAATAAATATAAATTATATTGTAATTATATATATTATAGTATAGTATAATATAAT ATAGTCGTAATTTTTAACTATACACAGTAATTCAATCTCATAATTTATCAAATGCTATTACACTGATTTGAGAACTAGTA CAATTACTATAATTATAGTTTACTACACTCAACTATTTTTTATAACAACTATTTTTTTTTCAGCATAACTAAAAATAATT TTTCTAAAATCTACAGCAATACTAAACTAGGCCTAAGGCACTGGGTAACTATGAAATTGGTCTATTGGGCCCAAAAAGTT AATAATTGTTTACTAAAAGAACAAAGGGAATAGCATCAATACTAACGAGCTTTAATAGTCCGACGAAAACCCAACACAAT AAAATAAACCAATATGGAAAATCATAGGCCAGAATTACTTTTGATAACTTGAATGCCTAATTATGAATAAGTTGGTTTTA TTTCTAAGCCGGTTTTTTCCATAAAATTTTGAGAATAATTATTTGGATTGAATAATAAATCGGTTGTAGGTATAAGTGGT AAATTAATTATCAATCTAATTAATAATTGATTAAGGTTAAACTATGGGAAGTAATCCAACGATTACGGATAAGTTTTTGA GGAAATTTCTGTAAGACAAAATAATTGTATTAACATCCATCACGAAAATTATTAATATTTAATTTGGGAAAATTAATTAT TAAACCATGGGATAATACGAAAAATTTAATATGTTCTAAATGAGTCTAAAATCAATTAGGATTTGTCTGATGACAATTTA CGAAATTTATACGCTGATAGTCAGTTGTCAATTCTATTAGGACACGATACCGACTGAGATAACAAGCGAGGATTAAACTT AGAATAATGCAACAGCGAAATCTAAGTACAAAACTTACCTACAACATGAATTTGTTTGAAAATGTTTGTTATGTATGAGA AATGTTTACCATGCATAAATGATAAAGGCTTACTACGTATGAATGACTTATACTTTGAGGATTTTTACATATCATAATTG CCTCTTTATTTATGAATTGAAATTTTATGCTCCTGAGTGATGATCAAAAGGTTATGGTAAATAAAACTAAATTAAGTGTC GTCCACCCTCCGACTTAAGAAAGGTCAGGTTAATTAAATTATGCTATATCAATATGACCTTAGGTATAGTTGGAGGGTAA CTCCCCTAACTCTCCATTGATTGCCCGTACTCAGTGCAAGCACAGAGCCCATAAAAAGTTATATGCATAATATGATAATG CATAAAATGTCATGCATATCCATTGAACTTCCATTGTGAGATTTCAAGTTTGTATTTGTTAAGCATTAGCTTATCATGTG TGTTTATGTTGTAGGTCATTCGGATAAGAAGCCTGTCACTTAAAACTTTAATCGGTAGACTGGCTGATGCGATGCATGGT GATAGAGATAAGAGTTTGGATACTGTCACACAAATTAATTCCGCAACTAAAAGTATTTTCGTAAGGAAATTTAAAAGTAT TTATATTTACAAGTATTTACGTAGTAAAATTATATGATGTAGTAATGTCGAATTTATAAATATTTAAATGTTTAACTTAT GTTTATTTCTAGATAACTATTTAATTAAAATTTCCACTAAAATAAGAAACGATTTAACTAATATTGAAATAATAACAAAA TAGCATAAAAGTGGTATTTTTGTTTTTTTTATCCTTAAGATTTCTATGTAAATTGTTATTAAAATATTTTTCCTGACGGT TATGTGTTTAGAATTCCAAAACTAAATTATCTAAGCTTTACAAAAAGTTTTATTAGATACTTATGTATTACGGTATTTCC AATTATCGCATTCTTGGAGACTTATGTCAAGTTGTTAGGATAAGTTTCATAAGTTTAAGTTTAAGTTTAAAAGAGAAAAA AATCTTTGAATTTTAGTAACTGGGAACTAAGTAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGA GTAAGTTTTGAGCAAGTCTAATGACGGTTTGAGAAGTCGGGTCTTTATATCAATTCTCGCCTAAAAGTTAGTAGTATACA TCACAAGGAACTTGGATGCTTCTGTTTACATCAATTTCTAGTATATACAGTGATCTATTTGGAAGTTCACTCATATATCG ACTTAATTAATTAACACGAGTAATTTACATAAAAAAAATTAAAATTGTAAATATTGTACATTAAAATTAGATGCGTCTAT TGACATCTCTTATTTTTTTTTTAATACTGTACATTCTTAAACCATCCCCTAATGTACTTATTACATTGTCCTTATTAAAA TTTCAAAAAAGTCCTAATAATTAAATTACTCATTGTTATAAATTGGGGATATATATATATATATATATATGTTATATAGG CAATAGTAAGACAAAGAGACAAAAAAGAGAGAGAAAATTTTCTTTAATTAAATCTTAGCTCACACTTTCTTTTCTCTATC TTACACACTTTCTTCTTCTCTTATATTATTTCCTCTTCTTCTATCTTTACAACCCTTTCTCGTCGATCGTTGTGTGTTGC TAATGAAACTAAGGATGCGTTTGGTAGAGGGATTCGTTCCCTGATTCGAATAATGATTCGTGGTTCGCTACAGTATTTTC TCTCACAAAAAATACACGTAAATCGAAAATAATTCGAATCACATGGTTTGAATCCTCCAACCAAACGAACCCTAAATAAC CTTATTCATAGATGAAGGGCTATGCTTGTGATACATCTCTAGGAAACTTCTCAGCAATTTCTTAAAGCTTATGTTTTCAT TTTGTATTCACTTTTTGTACATTATCACGGAATGGGAGTTCTATTCTCCAATGAACTTTTCACAGCTAGTGAGGTGGTAC ATCCATAATATAAAACTTCACAATACTCACATTCTACTTTTCATAACACATTATTATATATACTAAAGGAGAGGCAGGAT TCACTATTCATTGTACAGTAAATACAAAGAATTCCCGGTTTTGTAATTATTTTCTGATGCTTAATTTTTTTAATGCCCAT TGTGTCCTGTTATGTTATTTTACGTTTTTACCTTTGATTTTTCCTCATTGTCTGGCTTAGTTCGAGGGGCATTTTTGCCA TTGCATTTTTAATGTTGATTTTTTCTGCCTTCTGTCTCTCTTGGTCTTTGTGTCTTCTGGAGGGGAACTTTGTATAAATA GACTAAGTAAAATGTGTTTTTAAGTAAATAAACCACCAAAAAAATAAATTGGGTAAATAACCCAACTTCCACGTCAGCAT TCCACGTCATCAATTATGGTTTTAGGGTTTTCTTTCTCCTCCTCCTCTTCCATTTCGCGCCATTTTGTTCTCCCAGCCGC CTTCAATTTCTCCTCTCTTCTTCTCAAGTCATCGTCATCGCATAACCTCATTAATATTATTATCTTGCCTATTCAACGTT TTTTTCTCGTCCAAAACGAAGTTTGAAGAAGAGCTACTAAGTAAGTCTTTCATTTTCTATATCTCCAATGGTGTTTTTCG TTGTTGTTCATATGTTTTTAAGATGAGAATGTAGTTAAAAATCTATTAAAATAGTAATTTTACATCTTAAAAGACTAGTT TACATTGTCTGATATGATGAAGATCCGCCGGGTTTAGAAAAAAAAAGGTTTGTTCTTGGTTGGTTTGTGGTCTGTTCTTG GTCTGTTCTTGGTATGTTCTTATAACATGGTCAGTTCTGGTCGGTTCTTGGTCTGTTCTTATAACATGGTCGGTTCGTGG TCTGTTCTTGGTCTGTTCTCATAACATGGTCGGTTTTGGTCTGTTCTTGGTCTGTTCTCATAACATGGTCGGTTCTTGGT CTGTTCTTGGTCTGTTCTTATAACATGGTCAGTTCTTAGTCTGTTCTTGGTCTGTTCTCATAACATGGTCGGTTCTTGGT CTGTTCTTGGTCTGTTCTTATTGCACTGTCAGTTTTTAGTCTGTTCTTATCGCACAGTCGGTTCTTAGTCTGTTCTTGGT CTGTTCTTAGGTTGTTCTTATTATATGGTCTGTTCTTGGTCTGTTCTCATTATATGGTATGTTCTTAGTCTGGTCGTGGG ATATTTGGTTTGGTTTAATGACATATTATTATCTTGATTAAATTTTTACAGTTTTAAAATCTAAATAATGGCTCAGTGGA GGATTTTTTTTGACATTGGAGGAAAATGGGATGAGACTGAAAGTTGTTGGGTGTGGCATACAGATTGTAATTTAATTGGC ATATATATGGATGAGAAGGATACTCTCGAAACCTTCGTTGATAAGATTTGTAGAAAATGCAGAATTGATGGACAAAAACA TTCTTTACAACTATCATGGGTACCGAATTTGAAACAAAAATCGTTGCCCGTTGTAATAAAAGACAATGATGATTTGTTAT TCTTCAGGGATATAGCCCACCAGGTACCGCTACACGTGATAGTGGATAAGAAGTTTATGAATCCCGAAGAACATATTGAT GGAGTCAAAATTATGAGAAATCCTTTGCATGATGATTTTTTTGATCGTGATTTTATGGGTAATGTAGCTACAGATGAGTT TTCAACTCATAATGATATTCCACCACAGTCACAACCACAACCAGAGTCACAGCCACAGCTAGAGCCACAACCGCTTACCA TTTTAAATGAAGTAGAAGTTGCTGGTCCTTTAGTTTGTATGGACAAGACTGAGTTTGGATCATCTCATGGATCTACCTTC AGTGACGGATCTAGTTTAGAGGTTGGTCAGTACTTTACAAGTAAGAATGATTTGAAGGAAAAGCTGCATTTAATAGCTTT GAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTATCGCCTAGATGGTTGAATA AACCTGTGTACTTCAAGAACTTGGGCATCATGACAGCGATTGGCTCCACTTGTCTTTGCATCTGTTGATCTCTGTACATC ATAACAACTGAGTCATACACCTTTATGTTGAATTCAGATAAATCAACATAAAGCGTAACCCAATGCTTCCTCCCAATGTT AAAAGGCATAGTGAAGCCCTGCGCGCCATCTCATTTATGGCCAATTATGCGCTTTTGTCCACAGACATATTCATCTAGGT CGTTGTCAAACGTATATGTTGCCAATTTCTTTTTATTGATGTAGAATCGCGCTCTCAACTTTTGGCAAAATATATCATCT AGGATGACAACATTGTTATTGAACTGCCCTTCAGGTGCCCTTGACCTCCTAATCGATAGAAGACCCCATGCCTCGTCAAT TTGCTATAAGTCATAAAAAATTAATTCAATATAATGATAATGGTATAAAAAATAAGACTATAAATTTAGTAAATATGTTG TGATTATTTACATCATTGAACAGCCATTCACCTGGCTTCAAGATGATCTGGAAGAAGTCCTTCCTCCAATCTCTAAAACC GTACTCAATCAGCTCAAAGTCCGTACTAGAATCAGCGAACCACTTGTTGAAGGCCTCGACAGCATCGTTAAAGGTCCACA TCTTCTTCTTCACGTTACGCAGGGGATCTGTGTAAGGCGACTCAATATACTTGCTGGGCCTCTTAAGTCACTTTTCATTC TTCGATTCAGACTCTGGCTCTGAATGAACCTGCTCAAGCTGATCCTCAGGCTCTGGCTGGACCTGAGGCTCAAGTTCTGC CTCAGGCTCAAGCTGAACCTCTGGGTCAAGTTCTTCCTCAGGCACTGGCTTTGGCTGTAATTGTTGTTTCGCTAGACATG CTATATTGTCCTTAATTTCTCTAACAGATACGTCTAGCGAGTCTAGCCTCTTGTTGATGGCTTCAAAATGTCTACTATTG CACTCTACCATCCTGTGATAGAGTATGTAAACTATGTGATCAATAGACATACCATCTTGCTTGCTCGGCTGTTGTTGTTG TTGTTGTTGTTGTTGCTGCTGTTCAGGTTGTTGTTGTTATTGCTGTTGCTGTTGCTGTTGCTGTTGCTGTTGTTGTTGTT GTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGGGGAAGTTGCTGTTGTTNNNNNNNNNNNNNNNNNNNN NNNNNNNNCGGAGGCTTCGATTGCGGGACATGGACCATTCTTGCACCAGAGTCTAAAAATGATGCAAGCTGGTCAATCTC AGGATCTTCTTGGTCGGCATAAGGCATATACAACCTCATGCACATACTATTCATTTCCTCCTCAGTGGGATAAAGAATTG GTATGACCATTCTATGTATATTAAAAGAACATATATTCAATGATTGTTTAGGTGGAAACATATTGTAAAAAAAAAAACAA ATATGCCTATTTTGTAAAATTTACACCTATAAAAATATTGTATTTAAACCCTTACCTCGCCACTGTGCATGAGGTCGTCT ATATGTCTAACCTCAACCAATGAAACCCGGCGTGCCTCCTATTTGAGGATTTTGGGAAGACGTCCCTCAACCATCTTTGC AAACGTGGCGCCGATGGTTGGAAATGTTTCGAATGCCCAAACCTGCATTAAACCAATTTTTTTAAGTCTAGTAAACCAAT TATGGTATTATTTACTATAAGGTCATGAAAAATTATGCATATAACTCTATGACATACCTGGAAGGCCCAAGGAAACCCGC ATATTGAGTAGGTTTCCTTGATGCTCTTATTACGTCCTTTCCGAACCCATTTCTGGAATTTCTCTCTCAAGTTCTTCTTC AGAGCCTGCAGGGTGCATTCAAAAGACACCATGGCCCATGGATAGCTGTTGAAGAATTCTAAATCGTCAACGTAAGACAA CCAATCCAGTGGGACGGTCTTCTTCTCGTCCCCAGATAATAATACTTGTGCTAAAAAATAAATGATAGCGATCTTTGCTT TATCTCTACCTTTTATCTTCTTCCCTGTGAGCAATTTTCTTAAATCAGCAACAATTACTACGTGGGACTTAAAATGCTCC AATAATCTTCTATTCTTCAAAGCTTTCAAGATCACGTCCGGCTCTGGAGTTTCCCCGCAGTTCAATCCAGTAATTAATGC AAATTCCCTCATTCCAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGGCATTTCTGTTTCGGGGTCTAGATTCTGCCTGA TTACCTCCAAAGCCTCGATCTTTGATTTCATTGTCACTTTCACTGGGAAATATTGCCGCACAGGATCCATGATCATTTTT AGATGTTCGATCCCAAGAAGTTCACTTGTGTTGTACTTTGGGAGGTCATACTGAAAAAGAAGAAAAAACACACCAGTCAG AACCGACCAAAATGACAGAACCGACTAGAATAGACTAAGAAACCAACAAGAACTGACTGAACCGACCATGACCCGACCCA AAATCCCCGCAGAACCGACCAAACAGATAGAACCGACCAAAATTGAACAGAACCGACCAAAACCGAACAGAACCGACCAA AACTGACCTGAACTGACCACCAACCGACCAAGAACCGACCAAAACCGACCATACTCGACAAGAACCGACTAAGAACCGAC CACCAGAAACGACTTAAAACCGACTGAGAACAGACCAGAACCAAAACTGACTAAGAACCGACTATGAACAGACCAATGTT GCTTATATTAAGTTTGTGTTCTTGCAAAAATATATAAGAAAAAGTAAAACAAGAATATTACCTCGGCAGATTCCGTTGCC TCGTCGACAACTGTTCGGGAAATGGCCGTTTTAGTTGAGGAAGAAGAGCTGGTTTTTGATGCCATTTTAGTCAGATTTTG GTGAGCAGGTGGTCGGTTTTTGTGGTCGGGAATTTGGTGAGTGGTCGAGGTCGGTTTTTGGTCGGTTTTAGTGGGAACGG AGTCGGTTTTTGATGAACGATCGGTGTTTGGTGAGGTGGTCGGTCGGCCGAGATGAGAGAGATCGGAGAGTGGATCGGAG AGAGAGAGAGAGAGAGGGGGAGGGGAGAGGAAAGCCGGCGGTCGGGGAGTTACTGATCGGAGAGAAAAGCCGGCGGTCGG CGAGAGGTGATCGGAGAGAAAAACCGGTGGTCGATCGTGAGAGAGCTCAGTCGGGGGAGAGATGGTCGAGCGGTCGGTTT CGGGGGGAAGAGAGGGTCTAGCGGCGGTCGGTTTTGTGAGGAAATGAGATTTTTGAAAATGACCTAGGATTAATATGACC CATTTTTTGCCACGTAAGATACACGTCATTATTTTTTTGTTATAAAAAAAAATTGGCCTATTTCCTCAGATTCTAATTTT CTCCGGTCTCTTTTATCAAATTTTCTCCTTCTGGAGTCTTCTATCGTTGGCTTCTGGAGCCGTTTCCTCATCTTTGTGTC TTCTTCATTTTTTTTTTCCGCCCCAATTGCTTCTCTCTTCATTTGGTTTCTTTGATTCCATTTGGCCACAAGTGAACATC CATGGTTTATGTGATATTTGTTCTGGGTTCTTTGATTTTTTTCTTGCGGGATTTTGGCTTGATTTTTGGATGGTTTTTTG CTTCGTTTTGCTGTTTTCGCCTGATTTTTGGATGCTTTTTTACTTTGTTTCGCTGCAGGTTTTTTGAAAATTTTTCTTGC ATGTTTCTTTCTTGGTCTGATTTGCTCATTTAGTTTGGTTTCCTCTTTATTTTTTTGTCGAGTTTCCCCTTTATTTTTTT GTCGAGTCCATGTTCTGCTCATTTCTGCCTTTTTCTCTTTTTTTTTTCCTTTTTTTTTGGTTGGGTAAATATTTTCTTGC ATGTTTCTTTCTTGGTCTGATATGCTCATTTAGTTTGGTTTCCTCTTTATTTTTTTGTCGAGTTTTCCCTTTATTTTTTT GTCGAGTCCATGTCCTGCTCATTTCTGCCTTTTTCTCTTTTTTTTTTTTTTCCTTTTTTTGGCTGGGTTTTGTCTTTGTC GGTTTGATTTGCTCATTTAATTTACTTTTCTCTCTATTTTTGGTCGACTTAATGTTATGTTTTTTTCTTTTCATTTTTTT TTCTTTTTTTGGTTTTTGTTTCAATGGCTGGTTTCTTTTGTCATTGCCATGCTTCAAGAGATAATTTTTTTTCTGCTTTT ATTCTGGTGATTTTTCCTTTCTTTTTGTTTGCTATTCACTTTTGTCATTGATCTATTTCAGGAGATAAATTTGTGTAGAA AGAAGGTTCTATGAGTGTCTTTTGATATTCTTTGTTGCTGACTTCACCTGATATACAAATAAGTATCGATTTTTTTATTT TGCATTGATTAATTTGTTGATCTGTGATATCTAGACTGCTGATTTGGCTACTTAGGTTGATGATTTGTACCCAAATTGTT GCAGACACATTTACTTAGGTTGATGATCTGTACCTTAAACATATATTCTTTTGCTCTGGATTCATTAATTTGTTGATCTG TGATATCTAGACTGCTGATTTGGCTGCCTAAATTAATGATCTGTACCCATATTGTTGTAGACACATTAACTACTTAACTT GATGATATGTACCCATATTATTGCAGAAGCATTAAATGAACTGTTTCTTTTTTTTTTATTGTTAGTTAATTTCTGAAATT TGTGAAAAATCTGAAAAAAAAAATTTTGAAAGCTTTTCCTTTTTGTTTTTGTTTTTGTTTTTTTTTTCATTTTTTCCCTT TTTTGTGTTTCCTGAACTCATTATTATCTATCTATTATTTGGTTTTTGCTTCATATACCCGTACATTGCTTCTACCACCT GATTAAGCAATCTTACTTCCTTAATTCTTACAGACCGACTTTCTTTTGCTACGTGTCCTCTTATAAATCATGTACTGTTG AAATTTTTTCCCTCATTTACTCTTTATAAATACTTCTGCTATATCAACATTTTGTTATCTATTTGTCCCTTGCTCTCCCG AGACTTTGCTTTGTCTCCTTCATATTTCATCTCACGTTATTTACTACTCTGCTACATTCTCAATCATTGATTGCTCTTTC TATTCCTGTTCTTCTCCCTTGCGCTTGATTTTTAATCCTTTGCATTTCATCTTCGATTATTTATTACTCTGCTTTAATCC TACTCACTTACTACTCCAACTTCCTACCTTTGTATTTACTCACTTTCTTTGCTGGTTTTTGACTGGTTGCTATTTCATAT TTAAGGCAGCGTTTATAATGCTCCAGGTATTACTTATAACCTTTGCCTATAGCCATTCACTATTTGTTAATCTATGTCTA CTTTTTTCTTTTATTCTCTTTTCTTTACATCATAATTATGATTGGGATGGATTTTGACATCTTGAACTTTATATAAACAA TCCGAAAACAACTGTGATTGGGTTTATCTCACTTCCTCTTCTTATTCCCTGTAAAGCCGAGAATTGAAACCTGTCCAACT TAGAAAGAGAAAGGCATTCTTGGTTGTTTGTGTAAGTGAACGTTGCTCCATCTACAGGTAAATCCACCAACTGAATTTAG CTTCCAGGTTGATTTCAGTACCACTTATTTCATCCTAATTTTTTGATGACTTTAACTTAGTTTGGTCTATTGGTCCTTTT TTCCTGTTGGTGTCAAGATTTTATCTTAGTTTTAATTATTGGTTGTTCTATTCTTATTATTTCAGTTAGGAAACTGTCTT CATATCGTCTTTCTTCTCTCTTTTTACTTGCTCTAACATTTTTTGCTTTTTGGCTTTTTGGTTTCATCTTGGCATATTTA CTACTCATTCTTTTAAGCTGGCTCTACCTAATTTCTGTTTCATTGGCTCATACTCACTATTTCAGGCAATATTCCTTACA GGTACTTTTACTAACTCTTGCCCATATTTTCTTCATTATCACATACGCATATATCTGTACACATTTTTGCTTAATATATT TAACCCTTACTTGGTTTTGTATATGACAATGATACTTACAATTAAATTTGATCTCTTGACCTCTCTATAGTCGGTCCAAA ATTTGTTGACAAGAAATGCCACTTACTCATATTGAGTAAAATGATTTAAATGTTTCTTTAAATAGATTATAAAATCAGTT ACAGTTACATTACTTAGGCAAATAATTTTATATTTTCTTTATAATTGCTGAAGCAATCTTATGTTTAATAATATAATAAA AAACGTTAAGTTGAATTTATATAAAAATTTCAGATATTAAATTAACTCTTTATAAACAACTAAAATTTTGATAGTTTTTA GCTTAAGATAAAAATTTTAATTATAAACTTATATTACTTACTGCAAACTAATACTTTCCTTCCTTTATTAACAGCCAAAA TAATATCATATTCTATTGAACAAATGGATAAAACAAAGATTGGAAAAAAACAATCACGATCAAATCAACATATGCATCGT ATTATTTCAGACGTGGATAGAGGTTCTAAGAACGTGATTAATGAATATCGAAACCAGATTAATCAAAATAGCGGATCTGT ATCAATAACTTCTCGATCTAGATTTGATGCAATGTTGATTTCTGCATAGTCTCTAAATAATATCATGTCACTCCCGTCAA CATCTTACAATTGTAATGAACAATGTAATTTTCTTATTTCCTTATCTATAGTAATTACTATATTTTAGCAATTAAAATTC TTCTTTATAATAATAAAATTAACTCCTTATATGTTGGTTCTATAATCACTATTGATTTTCTTTTATAGGTACTATCAATA TGTATATTGATCTTGGAGATTGTTCTTACACCTGTCAATATTGTGGTGCTCTATTCTGATTTAATGAACGAATAAAAAAT AATAATCCTCCATTTAATCTTTGTTGTAGAAATGGCAGAATAAAATTGCCTTTACTTAGACAAACACTTATTGTATTAGA TGAATTACTTAATTATCATGGAGGTCTAATAAGTAGACATTTCCAAAGAAATATACAAACATATAATTCTATGTTTGCAT TTACATCCATTGGAGCAAACATAGAAACAAATACAATAAATTCTGATGGTCCATATATTTTCAAAATAAGTGGACAAGTG CATCATCTTATTGGATCTCTATTACCAGTTAATAATAATAGTCCAAAATTTACACAACTTTATATATATGATACAGAAAA TGAAATTGAAAATCGATTATCATCATTCTCATTTGATGATCAATCACAGAATTTCACCAGATTAATAATTGAAAGTCTTA TTAAAATGCTAGATAATACAAATGTATTAGTCAAAATGTTTCGAATCATAAGAGATAGATATAAAGAATATGATATACCA TCCATGAAATTGAGACTTATAAGCCGAAGAAACACTGATAGTAGCCAATATGAATTGCCAACCTCAAACGATATAGGTGG CCTAATAGTTGGTGATATTGATATGAACAATGAAGAGATATAATAATTCAAGACAAAACAGATACTTTACAAAGAATTAC TAAATTACATCCATCTTATATGGCCTTACAATACCCTCTACTATTTCCCTATGGCGAAGACGGTTTTAGAACAGATATAA AAATAATTACACATAACACAAATAATAAATCTACAAGAAAGAGAATTTATATGCGAGAATTTTATTGCTATCAACTACAA GAACGCAAATTTCAGGGTAATACTCTTTTTAGAGGAGTGAGACTATTCCAACAGTATATAGTTGATGCATATGCCTCCGT AGAAGAAGATCGTCTAGACTATATTAGAAAAAATTAAAAAAATTTGAGATCTGAAATTTATCAAGGAATTCAGGATGCTA TAAATAGAGGAGATACAAATGCACAAGCAATAGGAAAAAGAATTATTCTTCCTTCCAGTCACACTGGAAGTCTAAGATAT ATGATTCAAAACTATCAAGATGCAATGACAATTTGTAGATTCTATGAAAATCCTAATTTATTCATAACATTTACATGTAA TCCAAAATGGCCTGAAATTACTAGAGCCTTAGCAAAAATACCTGGATAAAAACCTAAAAACAGGCCAGATATCATTACAA GAATTTTTAAAATGAAATTGGACCACTTTTGATCAGTTATCAAAAATGAGAAAATCTTTGGCGCAATCATAGCAGGTTAG TAAACTTTTTCAAAATTTTCTGAATTTTATGAATAAAAATAGAAATAATTGATCATTTTCTTTTTTTCCATTTAATCAAA ATTTAACCAATTTTCTCTTATTTTTTCCTGTTCATTTTGTAGATTTATATGTTGTTGAATTTCAAAAAGGGGGTTGCCAC ATTCTCACTTCCTGTTTTGGCTATAGCCTGATCAAAAATTGCGTGAGCCATCACAAATAGATAAATATATCTCTGCAGAA ATACCATATCCAGAAAAGAATTTACTAGAGCATAATGTTGTTGTTGAATTTATGATTCATGGACCATGTGGTATGGCTAA AACAAATGCTCCATGCATGAAAAATTCACAATGCTAAAAAAAGTTCCCAAAACAATTAAGAAATGAAACAATTATCCAAG AAAATGGAATTGTAGATTACAAACGAAGAAATACAGTTTTTTATGTACAAAAAGAAGGCATAAAATTAGATAATAGATAC GTAGTTCCCTACAATAAAGACCTATGCATGAAATTTCATGCTCACATCAATGTAGAAATTTGTACACAATCTATGCTTAT AAAATATTTATTTAAATATTTAACAAAAGGACCAGATAGAATAAAAGCTGTTATAGAAGACAACATATGTACAGAAAAAT CTGAAAAAATTATTTATCAAGAAGTCGATGAAATAAAAAATTATATTAATTGTAGATATATAACGCCATATGAAGCAATG TGGCGTTTATATAAATATCCCATACATCATAGAAATCCTGTTGTTCAACGATTATCAATACATTTACCAAAATCACAAAA TGTAACATTTCATTCAAATCAACACCTCAATAACATAATAAGACAACCTGGTATTCATAAAACAACTCTTACTGAATGGA TGAAAACTAATAAACATGATATCAATGCTAGAGAATTAACTTATATTGAATTTCCAAGTAAATATGTTTGGAATAATAAA TATAAATATTGGTCTCCAAGACAAGCAGGACATACAATTGGACGAACCTTTTATATACATCCAAATACTGGAGAATTATA CTATTTAAAACTATTACTAAATCACCGAAAAGCAATAACAAATTATGAAGAACTTCGAACAGCTGACAATATTATATATC CAACAAACCAAGCCGCCTGCTATGCACTAGGCTTATTAGGAAATGATAGAGAATGGGATGAATCAATATCAGAAGCTGCA TTTTCCTCAACATCAATCCAATTACGACAACTATTTATCACAATTTTACTATTTTGTAATGTAAATGATCCGATCAAATT ATTTGAAAAACATTAGAAACTTATGACTGATGATATCATGAATAAAATTAAAACCTTATTTAATAATCCAAATTTTCAAA TACCCGAAATTGAATTATACAATTTTGTACTATATGAATTAGAAAAATCATTAAATATAAATTCATCAACTTTAACACAT TTCAATTTACCACTTCCGATTGGATCATTAATAGAAGATTTAAATAATAAACTACTACGAGAAGAACTAAATTACGACAC AAATGAATTAAAACATCAAAATATTGTATTAGTACAAAACTTGAATAATGAACAAAGATTTATTTACGAAGAAATTTTAA AATCACTCAATCATAAAAAAGACTTATCTTTTTCATCTATGGTCATGGTGGAACTGGAAAAACATATCTATGGAATGCAA TCATCACAAAGATTAGATCAAATAATGAAATAATTCTTGTTGTTGCATCTTCTGGAATAGCATCGCTATTATTACCTAAG GGAAGAACCGCTCATTCCAGATTCTGAATACCATTATCAATAGATAAATTTTCCACATGTCACATCAAAAAAGGAACTCA ATTAGCAAAATTAATTGAAAAAACATCACTTATACTATGGGACGAAGCACCAATGACTAACAAATATTACTTTGAGGCAT TAGACAAAACACTTCAAGATTTGAAGAATAATTTTGAACAACCATCGGTGGCATGACTATTGTACTAGGTGGCGATTTCA AACAAATTTTGCCAGTAATTCCTACCGGAACAAAAGAAACCATAATTAATGCAACAATAAATAATTCTTATCTATGGCCA TATTTTAGAGTACTAATATTAACAGAAAATATGCGCTTAAAATGCTATAACATTACTGAAGCAGAAAAAAAATAAATCAC AAAATTTTCAAATTGGATATTAGACATAGGAAATGGCACTGCTAAAGGAATAAAAGACCTAGAAAATGAAGATACTTCTT GGATAAAAATACCAAAAAAATATATAGTACATTATGAATCAGATCCAATTAAAAAAATTTCATCATTAATCTATGATAAC TTTAATTATTACTTTAATGATATTGAATATTTGAAACAACGTGCAATAGTAACACCCAAAAATAAAATAGCCGACGATAT TAATACTCATATGCTATCCTTGGTACCAACTGAATTAAAAACTTACTACAGTTATGACACAATTATGTCATCATCAGAAA ACATAGATGAACTTAATCTTTTATATCCTGAAGAATTTTTACACACCTTAAATTTCAATGGTATACCACCACATGAATTA AATCTTAAAGTTGGAACACCAATCATGTTATTAAGAAATCTAAATCAATCCATTGGATTATGCAATGGAACAAGACTTAT TATAACACAACTAACAAATAAAATTATAGAAGGACAAATAATAAACTCAAACAATATTAATGAAAAAGTTTATATTCCAA GAATAGAAATGACTGTACATGAATCTAAATGGCCATTTACATTAAAAAGACGACAATTTCCCGTAAAAATTTGTTATGCA ATGACAATAAACAAAAGCCAAGGACAATCATTAAATAAAGTAGGATTATACTTGAAAAATGAAATTTTTACCCATGGCCA ACTATACATTGCTTTATCAAGAGCAACAACCCCAAAAGGATTACATATACTAATACACAATTCAATCAATAAATATCCAA ATCACATTAAAAATGTAGTCTACAAAGAAATTGTACAAAACATTACACAAGAATATAGATCATAACATAGAAATATGTAT AATATCAAATTCTTTACAGTATTAATACAACTCTTTCACTATAATTCACATATCGATACAATAAAGTAATTTATTCATAT ACTAAACATTTATTCATTACTTTTGACAATTAAGAAAAATGACTATACCTATTCGTGCATTAAAACTAAATAAAGTGTAC ATCACTATCGTAGTAATAATCTCCAGATTATGAACGAACAACAACCTTACTACAAGACGTTTAATAAATCATGATTGCAT CTTAATTGACAAAGAAGTAACAATTTTTATGAATACTAAATTACATATTATTTGATATAGTACTGAACATTGTAATATAA CTAACTTTTTAATCTTTCCTATCTACAACATAAAGCAATACAAACATCGATATGGGCACGAGATTCAAATATCATTTGTC AAAAATGTAGAACAGGATAGGATATATAATATTGGTAATTTCTTTATTGCCAAAAATAAACCAACATATTAGTACATCAA AATTATTAACATATCAACATATTAATAATACTTTTTATTGACTGAATAACAAATGTTATTAAAGTCATCAAAAATATCCA AGCAATTGAAAAGACAAACAGATGACAGAGCCATCTAGAAAACGACTAAAAATCAAGTAATATCACTATTTCTAAATTCT TTATTTTAATTTTCCTAATTATTATACTAATATTTTCAAAAATTCCTATTTTGCAGCTACAGCTCCAAAAGAACCATCAA AAAAAGAAAAGTCAAAAATATAATGTAATGTACAAACCTTTTTACTAGACCTTTTTAGTACATCTCTAAACAAATACATA TATATATATATGTATATACATGTATATATATATGTATATACATGTATATATAAATTAATGTTGTAATGTAAAAATTCATG ATTTTCTCTATGATATAACAATCTTTTCCGCAGCAACGCGCGGGCAAAAATACTAG >DHH_3_2_Mno length=9112;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATACTACTTGAGTACTTGTCGCTTTTCGCTTGCTAATTAAGTAATAATGAATCTCCAAGAAACACTCGTGATAGGTA GATTACTATTGGGTTAAAGATTAAAACTAAGTACTTTATTACCTTAAACATATTTATTAAGATTACACACACATATATAT CCTCAATTATATTGGAGAAAAATTCTTAATTGTACACTAAGTTATTTGGATTCTCTTAATGCTTTTTTAATTGATCAAGG AGAAAACATATTATTATATATACTAAAGGAGAGGCGGGATTCACTGTTCATTGTACAGTAAATGAACAGTGAATTCCCGG ATTTGCCCCTCCTTGCTGATGACTAAATTTTTTAATGCCCGATGTGTCTTGTTATTTCCAATCCCTTTTTTTTCTGGGTT GTTTTTTATTTGTCTCCTTTCCTTTTTGGTCTCTATCGTTTTGCCTTCTCTGCTTTGCTTTATCTTGGCTTCTTCAATCC TTTATTTATTTATTTTTTTTGCCTTTGCTTTGGAGTTTTTGTCGTGATTATTTTTGGTCCAGAAATTTGGAAGTTTCAAA TTTAGGGTTTTTATGTGTCTTTTTTCCTGCGTTCTTCCATTTTTTGTTTCAGTTTTTTCTTTTTTTTGCCTTTGCTTTGG AGTTTTTGTCTTGATTGTTTTTGGTCCAGAAATTTGGAAGTTTCAAATTTAGGGTTTTTATGTGTCTTTTTTCCTGCGTT CTTCCATTTTTTGTTTAAGTTGTTTTTGCTTAGAATCTTCCATTTCCTCATTTAAAGTTTTGATGCTTTTCTTTCTTTTG TATCATTCTCGCAGATCCTTCATCTTGGGTTTTCCAGTCCCGTTTTCTTTTTGCCCCTTTTTTCCCCTTTTGTTTCCCCC CGGTGTCTTTTTTCTGGGTTGTTTTTTATTTGTCTCCTTTCCTTTTTGGTCTCTGTTGTTTTGCCTTCTCTGCTTTGCTT TATCTTGGCTTCTTAAATCCTTTGTTGTTTTTTTGGCTTTGCTTTGGAGTTTTTGCCTCGATTGTTTTTGGTCCAGAAAT TTGGAAGTTTCAAATTTAGGGTTTTTATGTGTCTTTTTTTCTGTGTTCTTCCATAATTTGTCTTTGTTATTTTGTTGGAT TTCCCCTGTGTTCTTACCGCATGATTCGTTCATTGTTCTTTGTTGCTCCTGCATCGGCTTGATTTTTTCCCCATGCATCT TTCGTGCAAGTTTTTTCATGGTCAACAATGTCTATTGTAGTTCTTTGCTGATTGATAGGTGATCTTTTGGTTAATCTTTG GCTTTGGTTTGTACTGAGAGAGCTTATGAAGATCAGTGCATTCTATGGTAACTCATTTTGTGCGAGGTATGGATAATACT TGATTTTTTTGTGTACTTTTAATCATTAAGATGATGATCTGTGCTGCCTACATTGCTGAGTTGTCTTCCTACTACGATGA TTTGTATCTATTCTTCTCCAGGCATATTAAATGATTTTGTTTTATTATTCAAAATCCGTCCCTATTTTACGGAGGAATTT TTTTTTTTGCCTGTTCTGTTTGCTGCTTTTATCTTTTTTTCCCTATAATTTTTTGCCCCTTCTGTTCTGGTCTTCTCTGA AGGTACATACAGTATTGATTTTATAATTTAATAAAGAAATTTTTATCCGCTATTTAATGTAAACCCAGTGCGCATTATTA CGTGTTATCTAATTACAGGTACGTGTTATCTAATCACAGGCCATTCACTGTTGACTTTTCATCCTTTAGTCCTTATTTAT CAATGCTGTTGCTCTTCATGCATTTATCATGTACATTTGTTTGTCTTTCCCATGCACTTGACATTTCTTCTCTTTTGTTT CATCCCTGATCATTTACTACTTCATAGCTCCGTTGATCATTTACTGCTTTCTTTGTATATCCCTGTCTCTTTGACTAGCT GTGTTGAGCTTGGCTTCATCCGTGATCATTAACTCCTTTATTCTGTTTCCTATCATTTAGTGCTCTTTTTTTTTTTTTAT CCTTTTATCTTTGACCACTTCCCTTCTACTTTGGTTGGTTGATGTCTTAGAATTAAGGCAGTGTTTAAGGCACTTCAGGT ACTATTAACAGTTTATAATTATGTTATTTAATGAATATTTACTGTTGATTTGTTAATAAATGCTTTTTTACTCTTCTTAT ATCTTATTGCTTACCACCTATATATGCATCTTAATTTCATATCTTTTGTGTCTAGCTCCTATTCTGTTTAAATTCTTTCT GTTACTTTTTCCGCCTCCTCTATTTTATTTACTCTTTTGTTTAAATTCTTTCTGTTACTTTTCCCGCCTCCTCTATTTTA TTTACTCCTTTTATATAGCAATGATGGGTATAATTGATCTTTACATGTTGAGTTTAGTGTAATTTGTCCATGGATTGCTG TGAATAAATTTTATTTTCTTGGATTTTGTTTTTATGTTCGTTTTTTCTGTCCCTTTTGCTTATTCTTATGTTTTTACCTA CTTTCCATTGTTGTTTAAGTTCAAAAATTATTTACATCTATATTCCTTTTCTTCCTTCAATATTCAATTTTCCCTTTTTT ACTTCCTCTCTTTCTTTTTCTTTACTTACTATATTTTTCCATCATTTTAAATTCTTTTGAAACCCTTATATTTTCTGTCA TTTTTATCAGGTTTGCTGCTTTTCTGAAGACTTTTATCATTTTTTGTTTTATTTTTTCTTTCCTTTCTCTTTACTGCCTC ATTTTTCTTTTTCTATTTTCTTCCACTTTCTTTCACTCTTTTTTGGTTTTTCCCCCTTTCTTTTTTTTTTTCTGTTCCTG CCTACATACATTTAAATTTTCTCGCACTTTCAAGTTTTCTGGATTCATTTTTGTTCTCTGCCCATTTTACACATATAATG AATCCATGTCTTTTTCCTTTCTTTTTGATTCACCCGGTAGTCCCTGGACAATTCAATTTTATGCTTTACTCCGGTTGGTC ACTTTCCTGGCACATGAGTTATAATCCGTCTGATGAATATGTTTCTTAATGTTCCCCTTTTTATGCAGTTGCCCATGGTA GGCAGCCATAAAAGGACAATGAACATATAAGTTCCCATATTCATCAGACGTTGCCGAAAATATCAAAAACCTGAGCCATA ATTTTGAAATAAAAATATTGTTACATATATTAATCTTCTCTTTTTTTTCCTTACTGGATTCTGGAAATATACATATGAAT GTATATGAACAATTGATTGTATCACTATTTTTTCCTTCCTGCAGTCTCTTTTCCTGTTCAATGACTTTCCAGTCTTTTCT CCTCTATGTTAACTGTGGTTACTATAATGTTTTAAGATAGAAATTTAAATTATAAACTTATATTACTTACTGCAAACTAA TACTTTCCTTCCTTTATTAACAGCCAAAATAATATCATACTCTATTGAACAAATGGATAAAACAAAGATTGGAAAAAAAA TGATCACGATCAAATCAGCATGTGCATCGTATTATTTCAGAGGTGGATCGAGGTTCCAAGAGCGTGATTAATGAATATTG AAACCAAATAAATCAAAATAGCGGATCTGTATCAACGACTTCTCGATCTAGATTTGATGCAATGTTAATTTCTTCACAAT CTCCAAATAATATCATGTCACTCCCGTCAACATTTTACAATTGTAATGAACAATGTAATTTTCTTATTTCCTTATCTATA GTAATTACTATATTTTAGCAATTAAAATTCTTCTTTATAATAATAAAATTAACTCCTTATATGTTGGTTCCATAATCACT ATTGATTTTCTTTTATAGGTACTATCAATATGTATATTGATCTTGGAGATTGTTCTTACACCTGTCAATATTGTGGTGCT CTATTCTGGTTTAATGAACGAATAAAAAATAGTAATCCTCCTACATTTAATCTTTGTTGCAGAAATGGCAAAATAAAATT GCCTTTACTTAGACAAACACCTATTGTATTAGATGAATTACTTAATTATCATGGAGGTCCAATAAGTAGACATTTCTAAA GAAATATACGAACATATAATTCTATGTTTGCATTTACATCCATTGGAGCAAACATAGAAACAAATATAATAAATTCTGAT GGTCCATATATTTTCAAAATAAGTGGACAAGTGCATCATCTTATTGGATCTCTATTATCAGTTAATAATAATCGTCTAAA ATTTGCACAACTTTATATATATGATACAGAAAATGAAATTGAAAATCGATTATCATCATTCTCATTTGATGATCAATCAC AGAATTTCAACAGGTTAATAATTGAAAGTCTTATTAAAATGCTAGATAATACAAATGTATTAGTCAAAATGTTTCGAATG ATAAGAGATAGATATAAAGAATATGATATATCATCCATGAAATTGAGACTTATAAGCCGAAGAAACACCGATAGTAGCCA ATATGAATTGCCAACCTCGAACGATATAGGTGGCCTAATAGTTGACGATATTGGTGAATATGAACAAGGAAGAGATATAA TAATTCAAGACAAAACAGATACTTTACAAAGAATTACTAAATTACATCCATCTTATATGGCCTTACAATACCCTCTACTA TTTTCCTATGGCGAAGACGGTTTTAGAACAGATCTAAAAATAATTACACATAACACAAATAATAAATCTACAAGAAAGAG AATTTCTATGCGAGAATTTTATTGCTATCAACTGCAAGAACGTAAATTTCAGGGTAATACTCTTTTTAGAGGAGGGAGAC TATTCCAACAGTATATAGTTGATGCATATGCCTCTGTAGAAGAAGATCGTCTAGACTATATTAGAAAAAATCAAAAAAAT TTGAGATATGAAATTTATCAAGGAATTCAGGATGCTATAAATAGAAGAGATACAAATGCACAAGCAATAGGAAAAAGAAT TATTCTTCCTTCTAGTCACACTGGAAGTCCAAGATATATGATTTAAAACTATCAAGATGCAATGGCAATTTGTAGATTCT ATGGAAATCCTGATTTATTCATAACATTTACATGTAATCCAAAATGGCCTGAAATTACTAGAGCCTTAGCAAAAATACTT GGACAAAAACCTGAAGACAGGCCAGATATCATTACAAGAATTTTTAAAATGAAATTGGACCACTTTTTATCAATTATAAA AAATGAGAAAATCTTTGGCGCAATCATAGCAGGTTAGTAAACTTTTTCAAAATTTTCTAAATTTTATGAATAAAAATAGA AATAATTGATCATTTTTTTTTTCCATTTAATCAAAATTTAACCAATTTTCTCTTATTTTTTCCTGTTCATTTTGTAGATC TATATGTTGTTGAATTTCAAAAACGGGGGTTGCCACATTCTCACTTCCTGTTTTGGCTACAGCCTGATCAAAAATTGTGT GAGCCATCACAAATAGATAAATATATCTCTGCAGAAATACTAGATCCAGAAAAGAATTTACTAGAGCATAATGTTGTTGC TGAATTTATGATTCATGGACCATGTGGTATGGCTAAAACAAATGCTCCATGCATGAAAAATTCACAATGCTCAAAAAAGT TCCCAAAACAATTAAGAAATGAAACAATTATCCAAGAAAATGGAATTGTAGATTATAAACGAAGAAATACAGTTTTTTAT GTACAAAAACAATGCATAAAATTAGATAATAGATACGTAGTTCCCTACAATAAAGACCTATGCATGAAATTTCATGCTCA CATCAATGTAGAAATTTGTACACAATCTATGCTTATAAAATATTTATTTAAATATTTAACAAAAGGACCAGATAGAATAA GAGCTGTTATAGAAAATAACATATGTACAAAAAAATCTGGACAAATTATTTATCAAGAAGTCGATGAAATAAAAAATTAT ATTAATTGTAGATATATAACGCCATATGAAGCAATGTGGTGTTTATATGAATATCCTATACATCATAGAAATCCTGCTGT TCAACGATTATCAATACATTTACCAAAATCGCAAAATGTAACATTTCATTCAAATCAACACCTCAATAACATAATAAGAC AACCTAGTATTCATAAAACAACTCTTACTGAATGGATGGAAACTAATAAACATGATATCAATGCTAGAGAATTAACTTAT ATTGAATTTCCAAGTAAATATGTTTGGAATAATAAATATAAATATTGGTCCCCAAGACAAGCAGGACATACAATTGGACG AACCTTTTATATACATCCAAATACTGGAGAATTATACTATTTAAAACTATTACTAAATCACCGAAAAGCAATAACAAATT ATGAAGAACTTTGAACAGTTGACATATTATATATCTAACAAACCAAGCCGCCTGCTATGCACTAGGCTTATTAGGAAATG ATAGAGAATGGGATGAATCAATATCAGAAGCTGCATTTTCCTTAACATCAATCCAATTACGACAACTATTTGTCACAATT TTACTATTTTGTAATGTAAATGATCCGATCAAATTATTTGAAAAACATTGGAAACTTATGACAGATGATATCATGCATAA AATTAAAACCTTATTTAATAATCCAAATTTTTAAATACCTGAAATTGAATTATACAATTTTGTACTATATGAATTAGAAA ATCATTAAATATAAATTCATCAACTTTAACACATTTCAATTTACCACTTCCGACTAGATCATTAATAGAAGATTTAAATA ATAAACTACTACGAGAAGAACTAAATTACGACACAAATGAATTAAAACATCAAAATACTGTATTAGTACAAAACTTGAAT AATGAACAAAAATTTATTTACGAAGAAATTTTAAAATCACTCAATCATAAAAAAGACAATATCTTTTTCATCTATGGTCA TGGTGGAATTGGAAAAACTTATCTATGGAATGCAATCATCACAAAGATTAGATCAAATAATGAAATAATTCTTGCTGTTG CATCTTCTGGAATAGTATCGCTATTATTACCTAAGGGAAGAACTGCTCATTCCAGATTCCGAATACCATTATCAATAGAT AAATTTTCCACATGTCATATTAAAAAGGAACTCAATTAGCAAAATTAATTGAAAAAATATCACTTATACTATGGGACGAA GCACCAATGACTAACAAATATTGCTTTGAGGCATTAGACAAAACACTTCAAGATTTGAAGAATAATTTTGAACAACCATT CGGTGGCATGACTATTGTACTAGGTGACGATTTCAGACAAATTTTGCCAGTAATTCCTACCGGAACAAAAGAAACCATAA TTGATGCAACAATAAATAATTCTTATCTATGGCCATATTTTAGAGTACTAATATTAACAGAAAATATGCGCTTAAAACGC TATAACATTATTGAAGCAAAAAAAAAAACAAATCACAAAATTTTCAAATTGGATATTAGACATAGGAAATGGCACTGCTA AAGGAATAAAAGACCTAGAAAATGAAGATGCTACTTGGATAAAAATACCAAAAAAATATATAGTACATTATGAATCAGAT CCATTTGAAAAAATTTCATCATTAATCTATGATAACTTTAATTATTACTTTAATGATATTGAATATTTGAAACAACGTGC AATAGTAACACCCAAAAATAAAACAACCGACGATATTAATAATCATATGCTATCCTTGGTACCAACTGAATTAAAAACTT ACTACAGTTATGACACAATTATGTTACCATCAGAAAACATAGATGAACTTAATCTTTTATATCCTGAAGAATTTTTACAC ACCTTAAATTTCAACGGTATACCACCACATGAATTAAATCTTAAAGTTGGAACACCAATCATGTTATTAAGAAATCTAAA TCAATCCATTGGATTATGCAATGGAACAAGACTTATTATAACACAACTAACAAATAAAATTATAGAAGGACAAATGATAA ACTCAAACAATATTAATGAAAAAGTTTATATTCCAAGAATAGAAATGACTGTACATGAATCTAAATGGCCATTTACATTA AAAAGACGACAATTTCCCGTAAAAATTTGTTATGCAATGACAATAAACAAAAGCCAAGGACAATCATTAATTAAAGTAGG ATTATACTTGGAAAATAAAATTTTTACCCATGGCCAACTATACGTTGCTTTATCAAGAGCAACAACCCCAAAAGGATTAC ATATACTAATACATAATTCGATCAATAAATATCCAAATCACATTAAAAATGTAGTCTACAAAGAAATTGTACAAAACATT ACACAAGAAAATAGATCATAACATAAAAATATGTATAATACCAAATTCTTTACAGTATTAATACACCTCTTTCACTATAA TTCACATATCGATACAATAAAGTAATTTATTCATATACTAAACATTTATTCATTACTTTTGACAATTAAGAAAAATGACT ATACCTATTCATGCATTAAAACTAAATAAAGTGTACATCACTATCGTAGTAATAATCTCCAGATTATGAACGAACAACAA CCTTACTACAAGACGTTTAATAATTCATGATTGCATCTTAATTGACAAAGAAGTAACAATTTTTATGAATACTAAATTAC ATACTATTTGATACAGTACTGAACATTGTAATATAACTAACTTTTTAATCTTTCCTATCTACAACATAAAGCAATACAAA CATCGATATGGGCACGAGATTCAAATATCATTTGTCAAAAATGTAAAACAGGGCAAAATATATAATATTGGTAATTTCTT TATTGCCTAAAATAAACCAACATATTAGTACATCAAAATTATTAACATATCAACATATTAATAATACTTTTTATTGACTG AATAACAGATGTTATTAAAGTCATTAAAAATATCCAAGCAATTGAAAAGACAAACATATGACAGAGCCATCTAGAAAACG ACCAAAAATCAAGTAATATCACTATTTCTAAATTCTTTATTTTAATTTTCTTAATTATTATACTAATATTATCAAAAATT CCTATTTTGCAGCTACAGCTCCAAAGAACCATAAAAAAAGAAAACTCAAAAATGTAATGTAATGTACAAACCTTTTTACT AGACCTTTTTAGTAGACCTTTAAACAAATATATATATATATATATATATATGTATATGCATATATATATAAATTAATGTT GTAATGTAAAAATTCATGATTTTCTCTATAATATAACAATCTTTTCCGCAGCAACGCGGGCAAAAAAACTAG