>DHH_20_1_Mno length=8630;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATATTATATTATAATTATATATTATATTATAGTATAATATTATATAGTTGTAATTTTTAATTATTCACAGTAATTCA ACTTTATAATTGATCAAACGCTATTACACTGATTTTGAAATTATTCACAACTACTATAATTATAGTTTACCAAACGCTCA GTTGCTTTTTATAACAACTGTTTTTTCTTTCAACACAGTTAAAAGTAATTTTTTCAAAATCTACAGTAATACCAAACTAA GCCTTTACTTTTCAGGAAAATCTATAGCACTGTACATACGTCATCAACATTTTCCTTAATATTTTTTGTTGGTTGAAATA CGTCATTACTTAGGTCATGTTATTGTTATTATTTCTATTCCCTCATATGTATGTCTCTGTGAAGACAGATTAATTCGACC GTTTCCTTATACTAATTTTATTATGTGTTCCGTACGTATTACCGTGTTAAAAATATTTAAAAATTTTATTCTTTATTGAA TAATTAGAAATTTATTATACGACTTAAGGATTTTTAATTTATTTTAAAAAGGAAATATGTGTAAAGATAACAATTGACTA AAAAAATAAGTAAGGATACATTTAAAGAAAATTATTATATCAAATAAAAAATAAAATAGAAACACATGCAAAAAAAATTA CTCTCATAAGAGTAAAGTGAAAAATAATATATTTTTAAAAAACACAAAAAATTCAAATGTAAAAAAATTCAAAAAAAATA AAGATAAAAAAAATAAAGAAATGAAGAAAAAGAGATAAATTGAGGATCTGCCAAATTGGCAGCCCCATAAAAAAGAATTT TAACTCCCATAATATTGTTAAATTATATACAATTATATCCACAAGAATGTGAATAACACAAAGAATATTATATAACTTGG CCGGTTGGACCCTTTACCCTTATGGCTTTCTTTGGCAACTTTGCTACGCTAATTACGCATTTATATTTCTCTCTTTTTTT GGGGGAATTTAACTCTCTTTTTTTTTTTTTAAACATGCAACAGACATGAGAATTGTCACATATATGTGTGGTTTTTCAAA AGTAAAATAAAATTAAGAAATTGGACGGTTGGACACACTTTCTGTGTTGAGTGCATGTTTTGGTGGGAATATAAAGCGCA TGTTTATTGCATGGGGAATATTAAAATAGTTTAGAAGGTATTTTGTTTCTTTTTCAAGTTCATTCTTCTTCTTCTTTTTT TGTTTTTTGGATAATTTTTCAAGTTCATTCTTAATTTCTTCAATTTCTTGCGAATCTATCTACCAATTTGTTTTGTAGAC TTTAAGATTGCCGATTACGCGTATCCATTGACTTCCTAAATTGCACACGTGGTACGTACGAGATCCAACTTCTTCTTTGC TTTTTTGCTATTAAAACTAAAATAAAAATAAAAAATACTCCTCCTTTGCTATTGGATAATTGTCACGTGGGAATGGGATA TACAGAAGATAGCGTTTGGACCACTAGAAAGTAATCTGCACAGGAACATTTTTCTTTTTTTTGGTGAAAAATCTGCGTAG GAACTTAGGATAGCCATAGAATCAATTAAAATATTCTACCCCAAAACAAGAGAGAGAATCGGTTAAAATAACTATATAAA TAGAGAAAATTCAAAAAATATCCCACAGTAAAATCCTTTATTTTTCCCTGCATTTTTAATAATTTAAAAGATATCCCTCA TGTTTTTAAACTATCCAACTCAGTCTTTCAAAAACAAAATAAAATAAAATTCAACCCTTTATGTGGTTAAATTGTTAAAA ATAACTTAAATATACTCTTAATGATCAATAACAAAAATTATCTTAAAACATTAATAACTAAGAAAACTAAATCTAGAGAA AAGAAGGTAAAATTTTCAATAAAATAAATTATTTTTATGAGAAAATCGAAAGCTTAACATGTCAAATTTGTCTATAGTTC TACACATGATCTCGCGTCTTCCCAGTGACACACGATTAGTGAGTTCGGACTCGTTATATCATTCTTGACCTACACTGAAT TTTGTTCTGCCATCACCCTAACACGTTAGCTTTTTTTAAATTTCTTGATTTTATTTAGTTATAAAATTTGTTTAAAAAGG TTTACATAATTAATGGTTAAAATAGTAATTATCAAGACTATTTTCAAGTCAGATTTAAGATTTTGTTTCTGGGACATAAA CTAAAAATATTGAATATGTTAAAAGACTAACAAACATCAACACCTAATTCTATTAATTTTTTTTAACATATTATTAATGC ACGTGCACATTGAATAGTTAATTGAACGTTTTGATAGGTAAATTAAAAATTTTAAAGAGTTTTTTTTTTTTTTGAATTTA ACTCTTAGTTTAGTTCAATAAAATAAAGTATATTTAAATAAAATGGACTGAATACACATTTCAATTAAATATTTTTTAGA TTAATATTATATATGTATAGACAAGTACAGTATATTTGAGTAATAAAGTTTTAGCAAGTAAATAGATTAAAATAATTTAT TTAGGAGGTGCATAATACGTTGAGAAAATAATAGTTGGAAGCGTCACGAGTAAAAAAAAAAAAAAAAAGTTTAAGTGTTC AAGGACCTATTTGAAAAAAAAAATATTACTTCAACAAAGACAAATTAGAAAAAATGTGTTTATGAGAAAGGGTTATTTGA AAAAGAAAAATCCTAAACTAGGAACGCATTTGAGAAATATTCTTCTAAAATGGGTCATTTAAAAAAAATTTATGAGGCTC ACTTATGATATAATAAAGATTACATTAAAATATCTTTTAGAAGGGACCGATTTGAAAGAAAAATATTTCCATAAGAGTAA ACTAGAAAAAATAATTTAATTTGGTAGATTTAAAGCTATAAGACTAAAAGAACAACGAAAAAAAAAAAAAAAACAATTGA GATTGGATTTTGGAGAGATATATTTGAAATTTTTGTCAATAAGAGGCATATGTGGAAATTTTAAAATCATAGGCTAAAAA TGAAATAAAAAAAAAAAAGAAAAAAATTCAGGGGGCATATAACCTTCATGCCTCACTTCCCTCCGTCATTGGCTATTTTA GTATTTCAAAAATTTTGACGAGTTAAAGGTTATCTTTTTACTCTTTTAAAAAGAATGTAGGGGATAATTTTAGGTAGTAT AAAAACATAGAGTTAGGTAGTATAATTTTTTATTTTGCTCTGCTAGGATTTGGTTCTCCTTCTTTTTCTTCTACACTGCT TCAATTGTAGGTTTCACTGGGCCAGAGTCTGGCGCCGCCGTAGGATGATGCTCCAAACACCTGACCTTGAGGGAGGGTCA CCAGATGTGGTGGCTTGGATCTCTCTGGGAAGGCGTCGTCTAGTTCATGGGTGGGGAGGGAAGAGAGGTGGTTGGGGACA ATTGGCGCAGCCTCCATTTGGTTGCCGTCCTTGGGAGCATCCTTGCTCCGGTAGATCTAAGCCCCTTGGGGTTTGGCTCC CTCAAATCGGCAGTTCCTTCAAGGGGGCTAGTGGTTGGTTCGACGATCAGAGATGGCGACGGAGGAGGTGGGCTGAGTGT CTTCTTCTAGTAGCGTGATGTGTTGCGGCTCTCTCGCCCATCCGTAGTGGTGCTCAACGCGTCATCGGAGTCTCTGCCTG TGTCTTTTGGTGTTTACTCTCTTGTTTTAATTTGTGTGTTTGTAATAAGGCGTTAATATTTCTGCCATTATGTTGTCATT TGTTTATATTTCGTTGTTGGTCGCTGGCGTGTGTTTGGCCTTATGTTGCTTTAGTGTGTCGTGTCATTGATGTTCCCTCG TTATGGGGGTTGGTAATCATACCATTCAGAGCACGAAAATTTATCTCGACGGGAAGGGTTTCTTCTACTAAAGCCTTAAC TATGCTCGTTCGTAGTGTGCCAAGGTGTTCTCCCGTTTTCGGGCCTCAAGTATGCCTCTATTCACTTGTTGAGTCATTAG CGTTATCTTGTGCATTTATATTTGATGTAGTTGTAAGTGTCAGTATGGCATCAATTATCTAATAATAACGTAGCTTTTCC TTAAACAGAGAGGATATTTTTTTATTTTAAAAACTATAGAGGTAAACGTAGGATTTAACTAAAACTTATGGGTACTTTTT GAATTTTCTCTAATAAATAATAAATTTTTTAATCTATTTTTTAAATAAAGATTTATCTTTCAAACGATTGAAGTAAGCAT CCACATTTATTTGTTTACGCGGTGTAAATACAACATTTATTGATAAATACTCCGCACAAATATTATATTTATCAAAAAAC ATTGTATTTTTATGTCGGGTGAGATAATATTAATTGATAAATATGCTATTTACATTAAATGTCTAAAAGATATGATATTT ACTTAAAAACCATTTTAAAATATGCTATTTGCCTTTTTGTCTCTTAAAATAATCTGGAATTTTAATTTAGGGTTGTCAAT TAGCCTAGTTCGTCCGCATAATGACTTGGATTTGGCTGTCGAAGCACTCATTTGCGTTTTAAGTGGTTATATTTACACCC ATAAAATTTATAAATGCACCTCAATTAATTATTATTTCCTAATATAAATTTTTTTAAAAAATCTATCCATTTATAGATAC TTTTTATATGATTCCGAATTTGACCCTTTCATACACCTGCGCCTACCCCCGCCCCACTTTCATTTTAATTTTATCTTATA TTATAAAGAAATAATTAACAAATCTTAACACTAATAAAGTTTTTCTCATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAGAAGCAAACACCAAGAAGAAAAACACTTATGTTATACGAGCATTGGATGAAAAGCAAGTTTTGAAACATTTTCTCA ACATAAACATTACGACTTTTTTTAGAGGAACATAAATATTACAATTGAAACATCATAGAGTTTCTTTAAAAAAAAATAAT TTTAGAAGCTATAGACAGTGTCTCTTACACATTATTATATAAAAAGTCAACCAATATTTCTATTTATGGCTGATATGATT TATTTTAATAGGTTTTGACGTAATTTCATTGTAAAGTAATACTATAATAAATGTAGATTATAATTTGGTGGGTATATTTA TGAATACTAGGGGTGCAAATAGAATTTCTCTTCCATTTTCTTCTTTGAACAAAAATCCTTAAAATTTTTGGGCCAAGTTG GCCCAACTGGCTTTCTATCCGAATTAGGTCGTCCTTCATCTTGCTTGAGTCTTGGGAAAATTTGAGTGCGTTTAGAATTC ATTCTAAAATGATTTTATTTTTTATATGAAAATAAAAATGAAAATGTTTTCAACCTCAGACAGAAATAATTTTTGAAAAT ACGTTTGGTAGTTTTATCAATAGATTATTTTCAGTATAAAAAAAATCATTAATGTCTCTATCGCTGTTCGAGTTTCCTAC CGATTTTCTTCGTCATCGGCTTCTCAACGTGATGACAACTTGCTGTAGATGCAATTCTGAGGAGAGAGAAAAAAAGGAGG TGGAGAGGACAGAGAATGGGTGCTGGGTTTGTATTGAAAGAGAAGGGAGAAAATAAAATTAGGGTATTTTAGGAATTTTA TTTGGGTATAAATCTCAGGGTGTATTTGGTAAGAGGATTCGTACCCTGATTCGAATTATAGTTCATAGTTCGTTACACTA TTTTTTTTCACAAAAAATACACGTAAATCAAAAATGGTTCTAATATCATAATTATAATCCATGAACCAAACGTCTCTCAA TCCTATTTACTAACTAATTTTAAATCTTGATCTATTAATTTTTATTCTTATCCTACTTTGGTCTATTTTCCTCATTCTTT CTAACTTTAATGACATAAGATAAAATAATGTTATTTTATTGATGACATTATTAAAGGTTCTGTTTATTTTATCAATTTGA GTTTAAAATTCGAGTTTTGTTATAGTAAAAAGTTTTCAGAAGCAGTCACATCTAACTTTTTTTATTACAGTAAAAAATTT TCACATAAAGTTACATCTCAACTCGAATCAGCGAACTAAACGGGCCCAAAAGTTCCCCTAAACTAATTAAGGCACCCCTA CTATTGTAAAAAGACAAAACAGACCAATATATTTAAAATTAGTTAAAATACTTGAAAAGCCCCAAATTATAACGAAGAAC ACGTATTTTTTCACGGACGATGAACATCTCTCAACCCATTCACTATTTCTTAAGCAAAGTAATATTATAAAAACACGTTT CTTTTTCTTAAATGGTAAATGAACGATAAAAATTTGTTTCAAAGGAAATTGGAATATACTAAAAATCGAGTGCAAAAGTA CGCTCTCTCTTCTCAATCGTGTTAAATTTTGTTTTGTGAAATTAGCTATGTTTATTACCTGCATATTAGAAATTTTGCTG CAAAAAATTTTGTGCGCCAAACTATGAAGTAGAAAGAAAAGTAGAGAGACAACAACGATTCAAATAATTTAAATGAAATT ATTACTACAAAATTAATAAGGATGTTAGATGAAACAAATACATTACTTAAATTATTTAGAACGGTTAGAAATTTTAACAA TAATAAAAAACACAATCAATGAAATTAAGATTAATAGACAGATGAGAAGGAGATAGTATACAATATGATCTTCCAACTTC AACAGGTTTAGGAGCTTAATTGTTGGAGATATTGGTGAATATGAAAAAGACAGAGATATAATTATATATAGTTGTTGTGA GGGAAAATATACCTTGCCATGTCAGACAACGACTGACCTCCACGTGACCATCACTTGCCATGTTAGCCAGCAGTCAGCGT TCAAAATTGAGTGGCGTTCCGATGGTGAAAGGATCGACCGTATGAGGTACTTTAGAATAATTCTTGGAGGAACACTCAGC AACAGTAGGCTTGCAGCTATCGTCCCTACACACAGTTGAGACATGTATGAATTGGAATCCTTAGCAGACCAACGATGCCA TAGAAGGATCGACCGGGATGAAAGCCTCCGCTTTGACTTGCTGAGATACAATAGAGACGCAGAGGGTGGGACGCTCAGCT TTTGACCCATATCCCAAGAGTAGTCTCTGAGGTGACAATGGAGAAATCCCTAGGTTACTTCTGGGTTTAGGGAAAGTCAA TAGCAAAGAAAATGATTACATGTCTATAAACCACCTAAAACGGACCAATGAAAATCACAGAAGATCCACAGCGCCGCAAT AGTGGACAAATTAGGTGAATAAACAGTCAAAAAGGTACTAAAAGGCTACAGTCTAGGCGGGTAGGATAATAGGCTACTCA AGAGAAACCGCCAGAGAACCCCCTGTCTCAGTCCTCCCAATATGTAATCTGTGAGATATAAAAGGGACAATGTCCTAGGG GGACAGGGGGAGGTAAGATTGAGAGAGCAAAGCCCTTGTAATCAAAGAAGAGAGAAAATAGTAAAAAACTTCTTCGAAGT GGACGTAACTCTTTCTTTGAGAGTGAACCACTATAATTTCTGGTGTTATTCTTTTTTATTTGCACTTGCTTACCTATTCA CACACAACCAGTTGCACTTTCCTGATATTACAACCAGTTTTAGCCGGTAGCCTGACTGACTACTAGGCGGTAATCTTGTT GACGAAATTTCACCGTCAACAATAGTCAAACTGTAGAATTACAAAGAATTAATAAACTCCATCCATCTTATATGGAATTA CAATATCCACTATTATTTCCTTATGGTAAAGATGGATATAGAATTGATACAGGATGGAATCCATTTACAGGAAGAAACCC ATGTAAAACCGAATTTCAATGAGATCGTTTTATGCTTTTCAATTACAACAACATTTACATGAAGGAAATACATTATTTAA AAGTGGAAGACCCTTCCAACAATACTACAGATGCCTATGCTGTTGTTGAAGAAGATCAATTAGACTGTGTTAGACAAAAT CAAAATAATTTAAGATCTGAAATCTATAAAGGTATTCGGGATGCTATAACTAGAGGTGATACTGACCCATAGGCAATTGG GCAAAGAATTGTTTTACCATCATCTCATACTGAAAGTCTAAGATATATGATTCAAAATTATCAAGATGCAATGGCAATAT GTAGATATTATGAAAATTCTGATATATTTTTTACATTTACATGCAATCCTAAATGGCTAGAAATTGTAAGAGCTATAACT TTAATTCCAAGACAAAAATCTAATAATAGACCATATATCATAAGCAAAGTTTTCAAGATAAAATTAGATCATTTAATGAA TACAATAAAATCAGGAAATATTTTTAGACCCATAATAGCAGGTACACTATTCTATTATGTCACTTCAATACAACCTGAGT CTACTTCTTCCATTAGCTCTTAAAAAAAATCAATCAGATAATACTAATCTTTATATATTAAAACAATTATTTCATTAAAA ATAAAAAAAATTATTACCATCAATTATAATATATTAACAACTAATATTGGTTTTTTGTCTTTCTTCAAACAAAATATATA TATGTAAATATATAGATATATATAAATATGTAAATAAATATGTATATATATGTAATAAATTTACCACAGCTTGGAAATTG AACTTTAATCGTATACCATCGTTTGTGTTAACTTTTAATTATCATTTTCATACTCTATTTTTGTAAAATATTTAACAATA TAATCATCATTTTGTAACTAAATATTATATTGTTTACTCTAATTTTATAATAGCACGGGTAACCCACTAG