>DHH_2_1_Mno length=21986;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATAATAAAATATACTTACTTTACTTTACAATACAATATTGGAGGATACTATATATGGTTATAATCAATTAATTTTTT CTCATCTGTTATTTATGATATTATTATTACAAAATATTTATAAATTTGTTACTTTTATTTCTGAATTTATATATTCAATT TATATATGTTATATTCTTTTATATCATAATAATTTTATAGCATTTATTCATTAATTACAAAATTCTCATGAATATTTGTT TATTGTGCTATGTACATTTCATTTATCTTATTCATTAAATAAAATTCGTTATACTGTTTTGCTTAATATAGTAATAATAT AAGCTCATATGCCATAATCTTTTCTAACATAAATATAAATCTTACAAATTAGCTTATTATATCATAATATATTGTAATAC ACAGATGGAGCCGAAGAAAAGAACTAAAAAAATGGCCATAAAATCTAACTACCGCATTCGTCGTATCATCTCACTTACGG ACGAGGATTCAACAGTTGTAAATACTGATTACTCAAGTAAACCAAGTTCTGGTATAAGAGATTCAATCACACTAATCCCT CGATCCAGAGTTGATGTGATGCAACATATGACCCAAACTGAAAACAGACATATACTACATATGTCTGAAATTGAAAGCCA ATCTATGCAACATATGTTTGAAATTGAAAGCAGATCCTCTGAACAAGTTCGTGCATCAGCAATTGAAAACAACATAGAAA ATCGTAAATTTCTTACTTATATTAAATAATATATTTTTTTAAGGGGAAAAAAATTATCACAAACTGATCTAAATTTTTTT TCTTAGGTGATACTAACATGTATACCGACTTTGGAAACTGTTCTTATATCTGCCATTATTGTGGTGCTCTTTTTTGGCTT AATGAACGAATCAAAGGAAGTAACCCACCTAAATTCAATCTTTGTCGTAGACAAGGAAAGATTAGAATACCTTTTATTAA AGATATTCCTTCTATACTATATAATCTACTAGATTATTGTGGAGGATCCTTGAGTACACATATTTGAAAAAATATTAGAA TTTATAATTCTATGTTTGCATTTACATCATTTGGATGTAATATAGAAAATTTCCCAAAAAACTCTATCGGCCCTTATATT TTTAAGATGAGTGGACAAATACATCATTTAATAGGATCTCTTCTTCCAACTGATAACAATCCCTCTAAATTTACACAATT ATATATATATGATACAGAAAATGAAATTGAAAATCGAATGGCTTCATTCTCATTTGAAAATGAATCAAAAGATTTAATAA AAATAATAATTGAACATTTAATTACAATGTTAGACAATACAAATAATTTAGTAAAAATTTTCCAATCGATAAGAGATAGA TATGAAGAAGATAAATTACCATCCATGAAACTAAGACTTATAAATCGAAGAAGTACAGATAATAATCAATATGAACTACC AACTTCAAACGATATAGGTTGCCTAATAGTTGGAGACATTGGTGAATACGAACAAGGAAGAGACATTATAATTGAAGATA AAACAAATTCTTTACAAAGAATCACAATACAAAGAATCACAAAGTTACATCCCTCTTATTGTTGTCCCGAATAAGGCTAC CTAAGAGGGGGGGTGAATTGGGTTTTGAATATTTTTTTAGAGTTTATATGATTCTTCAAAGATTAAACTAAATATAGACA ATTAATTGAACAAAGAACCTTTAACAAACACTTGGTGTACAGAAAATTATGTAAGTTAATACAATAGCTCAATCACACAG AAAATTATGTAAGTTAATACAATAGCTCAATCACTTGATTTACATGAAATAGACCAATCTAATATGATAAAAAGAGTTCA ATAAATTTATCACGATGAGTTAAGACAATCCATGTCAGCAATTAAATTTGAAGTGCAAAAATTAAAGAGATAGAGTTAGA GAGATGCAAACGAGATTTATAGTGGTTCGACAAATGAATTTGCCTACATCCACTGTCGCCGAGATATTCCGCCTCTCGAC CTCTTTCACTATTCAATCGACTTTCCGGCACGATCACTCCTCTTACAAGAAGGCGAATCTTTCTACCCGAGGCTTCGCCT AACCTCTTACACAATGTCGATTTTTCACGGAGATCGACCAACCAAGTAACCCAATACCAAAGTAATGATTATGAGTAATG AAGCACTTAGTTTCACTCTCCTAACAAAGGTTTTACACAATTTGAAATCACTAGGAGATGATGAACTCACACTATCACAA TATAACTCAAGTTAGGCTCAAATGTATGTGAGAGAGTTAAGAATTTTGAGAAGATGATGATTATGTGGACACAAAGGAGA ACTCTCTTTTAGATTTATGAAACTTTGAACTCGTTCTCTGTTTTTCACAAGGATAGCTATTGAGAAAAAANNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNACGTTGAAATAACGAAAAACCTTTGTTAGCACCATCCCATACGGAAGACTCGGATCCCTAGCCAAATT ATTGCCCTCCACCATCTTGTGAATGATCAAATAGGGAAGGTTTGTCCGTTCACTTTGGAGAAGGCAGAACATCAGATAAA GATCAGTGAATGAAACCTCATCCCTATGCCCTCCTCTAGGAGTGATATTGTTTGAGATAATGTGGTGAATGACTCTACTC CTAAGGGGTAGTTCATTGGCTTTTGGCTTTGGGGGTAGAGGCTCAATCTCGTCTTCATCGCTCCATTGAGTTGGGGTTTT CTCCATAATAATCCTTGACATTGTTTCCCCATGATAAGCCCAAGAGTCACAAGTATGCACACATTTTCCCACATTCAGAA TCCCAAAAATGTTTGAGATTACCTCTCTATCAATTTCTATGCGTTGTCCCTTGAGAGTGCATGATAGTTGGACATTGGAG TCACACGTCGTGTATTCCATATGGGCATAAAAGGCTTTTACTAACCTAGGGTAGACTACTTCCTTAACCTCCACAAATGC TTTCCAACCTAGAGTCTCAAACAATCTCTCAATGTCTAACTCTCTAAACTCACTAAAATCCACAAATCTTCCTTCTACAA TGGATTTCTTTTCAAAAAGCTTAAAGGAACGAGAATTAAATTCAGCATTGGATACCTTCTTTCGTGGCCCAGAGGAAGTG GATTTCACATTTTTTCCTTTTCCACGTGATGATTGACCCTGCGAAGCCATTGAAGCAATCTGTCGAACACTTTGTGGGTG ATTTCCGGATTGAAGTGGATTTGAAGTGAAAGTTGAGAAAGAGTGGAAAGAGATGAGAATGTGTGAGGAAGAACGTTTCT TCAGAGGGTTTGATTATGATTGTAGAGGAAATTGGAAGAAACTCGGATGATTTTGAGGGATGTTGTAGATTGGGGGTGTT TTTGGCTCCTAGGGCTCGAGTTTGAGTTTGAGTTTGAGAGATTGAGGGAAAATAAATCTCAGAGCCGATTTTAAACTGCC TGACGCAAACCACCGGTCGCCCGATGTGGTCGACCGGTCAAGCTTAACCGGTTGACCGGTTGATTATAACTTCTCTGTCT CCGGTCGACCGGTGTATACAGAAAACGTGAAAGGATAGTTGATTTTGGCAGACAAGGCCAGATCAACCAACAACCAAATA TAGCATATGTTTCCTCATACACCATCACACAAGCAAAATAACAATATCAATCTATTTCAGCATCAAATTATCTAGTCATA GATCAAATTCTTAATTCCTAAGTGATCAAATTTAGTTCCGTAGCATCTAATAATCCTAAACCTCTTCTAAGTGAAGCAAA TCTTTCAAGGGCTAGAGGCTTGGTAAGGATATCCGCAATTTGATGATTAGGGCTAATGAATTCTAATGTGATATCACCCT TTTGTACATGATCACACAAGAAATGATGTCTAATTTCTATGTGTTTGGTGCGTGAATGCAAAACCGGATTTTTTGACAAG TTGATTGCACTAGTGTTATCACACATGATAGGCACATGATCATAGCTCAATCCTAGGTCCAGAAGTGTTTGCTTCATCCA AAGGACTTGCGCACAACAGCTGGCTGCCGAGATATATTCGGCTTCCGCGGTTGATAGAGCAACCGAATTTTGCTTCTTGC TAAACCAAGACACTAGTGCAAATCCTAGAAAATGGCATGTACCACTAGTACTTTTCCTATCTATGGTGCAGCCTGCCCAA TCGGCATCCGAATAACTAAACAAGTCAATGTGTGTGCCCTTTGGATACCATAATCCTAAATTCTTAGTGCCACTAAGATA TCTAAAAATTCTTTTTACCGCATTTAGATGAGACTCTTTAGGATTTGATTGATATCTAGCACATAAACAAACACTATACA TAATGTCTGGTCTACTTGCGGTTAAGTAAAGTAAGGATCCGATCATACCTCGATATTTCGTTATGTCCACTGCCTTACCA TTTACATCCTTGTCTAATTTTATAGATGAGCTCATTGGAGTAGATAGAGGCTTCATGCCTTCAAAGTCAAACTTCTTAAG TAGATCTTTGACATACTTAGCTTGATTGATGAAGATGCCTTCCTTTGTTTGTTTGATTTGAAGACCAAGGAAGAAGTTAA GCTCTCCCATCATGCTCATTTCAAACTCACTATGCATGCATTTTGAAAACTCTTCACAAAGGGAAACATTAGTAGAACCA AAAATAATATCATCAACATAAATTTGTACAATAATTAGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGTATCCATTATTGTTTCCTTATGG AGAAGATGGTTATAAAACAGATTTAAAATATCATGTAAATAACACAAATACCACATACAAAAGAAAAAGAATTTTCATGA GAGAATTTTATTGTTATCAATTACTAGAACATCAAAATCAAAGTGATATCCTATTTAGAAGTGGAAGACTATTACAACAA TATGTAGTTGACGCATATGCATGTGTAGAGGAAGATAGATTTGATTACATTAGAAAAAATCAAAAAAAATTAAGATCAGA ATTTTATCAAGGAATTCAGGATGTTATTACAAAAGGAGATACAAATGCACAAGCAATAGGTAAAAGAATTATTCTTCCTT CCAGTCACACCGGAAGTCCTAGATACATGATCCAAAACTACCATGACGCAATGGCTATTTGTACATATTATAGAAATCCT GATTTATTCATAACATTTACATGTAATCCAAAATGGTCAGAAATTACTAGAGCTTTAATAAAAATACATGGTTCTAATTC TGCAGATAGACCCGATATTAGCGTAAGAGTTTTTAAAATGAAATTAGAACATTTTTTATCAACAATAAAAAATGAAAAAC TTTTCAGAAGAATTGTAGCAGGTTAGTATATTCTTTCGACATCTGCGTTTTTTTTATTACCTATAAACATTAAATAATAT TAGATATTTCTTCTATTAAAAATATCTAAACTAAATTTTCTGTTCAACTTTTGTAGATCTGTACGTAATAGAATTTCAGA AACGGGGTTTGCCACATTGTCACTTCCTGTTTTGGTTACATACCGATGATAAACTACATGATCCATCAAAAATTGATAAA TTTATTTTCGCAGAAATTCCTGACCCACAAAAAAACAAAATAAAATACAATGTTGTTGCTGAATTTATGATGCATGGACC ATGTGGAATAGCAAAACTAACTGCTCAATGTATGAAGGACTCAGAATGTTCCAAAAAATTCCCGAAACAAATTAAAAATG AAACATATATTGAGGAAAATGGATTTGTCAATTATAGAAGAAGAGCTACAAATTTCTACGTTGAAAAAGATGGTATTAAA TTAGATAATAGATATGTTGTCCCACACAATATAGATCTATGTCTTAAATATAACGCTCACATTAATGTAGAAATATGTTC TCAGTCAATGCTTATAAAATATTTATTTAAATATTTAACAAAAGGATCTGATAGAATAAGAGCAGTCATAGAGGAAAATA TTTGTACAGAAAAGTGTGGGGCAATTATTTATGAAGAAATAGATGAAATAAAAAACTATCTTAATTGTAGAAACATAACA CCCTATGAAACGTTATGGCATTTATACGAATATCCAATACACCATAGAAACCCAGCCATTCAACGTTTATCAATACATTT ACCAAAAATGCAAAACATAACATTTAGATCAAACCAACATCTACTCGATATAATAAAACAACCATATATTCATAAAACAA CTCTAACTGAATGGATGGAAATGAATAAAACTGATATCAATGCTAGAAATCTAACTTATAATGAATTTTCAACTAAGTAT GTTTGGAATAGCAGATATAAATATTGGTCTTCTAGACAAATAGGACATAGAATAGGCCGATCATATTATATTCATCCAAA CTCTGGAGAATTATATTATCTAAAATTGTTACTAAACCATCGAAAAGGAATAACAAGCTATGAAAATCTTCGAACTATCG ATAACATAACACGTCAAACATATCAGGCAGCATGTTATGCATTAGGTTTATTAGGAGATGACAGATAATGGGAACAATCA ATATTAGAAACATCTTTTTGGTCTACATCATCACAGCTACGACATTTATTTATTATTATACTATTATTTTGTAATGTAAA TAACCCACTCAAATTACTCAAAAAAAATTAGAAACTTATGACTGATGATATCTTATACAAAATTAAAAAATTTTTAACAG CCCATATTTTGAAATACCAGAAAATGAATTATATAATTTTATATTGCATGAACTAGAAAAATTATTAAACCTAAATTCTT CAACTTTAGCTCATTTTAATCTACCCCTACCTACTGGTTCACTGATAAATGATTTAAACAATAAACTTTTAAGAGAAGAA CTTAATTATGATATAAATAAATTAAAAATAGAAAATTCTTTGTTTGTAAAAAATTTAAACAATGAACAGCGAATTATTTA CCATAAGATTTTAGAATCTGCTATTGATAAACAAAACAATTTATTTTTTATTTATGGCCTTGGAGGGATTGGGAAAACAT ATTTGTGGAGTACAATTATAACAAAAATTAGATCTAATAATGAAATAATTCTAGCTGTCGCATCTTCAGGAATAGTATCA CTATTATTGCCCAAAGGAAGAACTGCGCATTCTAGATTTCGAATACCATTATCAGTAGATAAATTTTCAACATGTCATAT AAAAAAAGGAACACAATTAGCACATTTAATTGAGAAAACATTATTAATTTTATGGGATGAAGCACCTATGACTAATAAAT ATTATTTTGAAGCATTAGATAAAACACTTCAGGATTTATGAAACAATTTTGACCAACCATTTGGGGAAATGACAGTTATT CTAGGGGGTGATTTTTGACAAATCCTACCTGTTTTACCTACCGGAACAAAAGAACACATAATAGATGCATGCATAAATAA TTCATATTTATGGCCACACTTTAAGGTTTTAACATTAACAGAAAATATGCGGTTAAAACATTTTAATACAACATCAGAAG AAAAAAAAGAAATTGAAAATTTTTCAAAATGGACATTGGACATTGAAAATGGTACTGCTGAAGGAATAAAAGATTTAGAA AATGAGGATATTACATGGATAAAAATACCTAAGAAATATTGTGTAGATTTTGACCTAGATCCAATTGAGAAAATAACAAC ATTAATATACGATACCTTTAATAACAATTTTAATAACATTGAGTACCTAAAACAACGCGCAATTGTAACACCGAAAAATA AAACCGCCGACGATATAAATAAACATATATTATCCTTGGTGCCTAATGAGCTAAAAACTTATTATAGTTATGATACAATA CTACCTTCATCAGAAAACATAGAAGAACTAAATCTCTTATATCCTCAAGAATTTTTACACAATTTAAACTGCAACGGTTT ACTACCACATGAACTAAATCTTAAACTAGGAACTCCAATAATGCTTTTGAGAAATCTAAATCAATCTGCTGGACTATGCA ATGGAACTAGACTTATCGTAACACAGTTAACAAATAAAATAATAGAATGACAGATCATTACTTCAAATAATATTTCCGAT AAAGTTTATATTCCAAGAATAGAAATGACTGTACATGAATCTAAATGGGCATTTACTTTAAAAAGACGTCAATTCCCTAT AAAAATATGTTATGCAATGACAATAAATAAAAGTCAGGGACCATCTTTGAATAAAGTTGGACTATTTTTAGAAAATTAAA TATTTAGCCATGGTCAATTATATGTTGCTTTATCTAGAGTAACTAATCCAAAAGGCTTATATATATATATTACTCAATGA TTCAAACAACAATTATCCTAATCATATAAAAAATATTGTCTACAAAGAAATCTTACATAACATCACATAAATAAATATAT ACAAAATATATACCACCTTATATTCTTCACAACATTAAATTTTTTTTAATATAACATTTTTAACAATAAATTCAAATAGA ATATTTGTCATTATAACAACACTTTATTTACTTTTTTCAGGACTAAGAAAATATGACAACACCTATTCGTGCACTAAAAC CAAATGAAGTCTATGAAACAATACAAGCACGAGTATGCAGAATATGGACAAACAACGATTTTGTCACAGGACGCTTGATA AGCCTTGACTATATCCTGGTTGATGAAGAGGTACTAAAATTTTAAAATATTATATTACATATTATTTCATGTAATATTTA TTAATATTGAATAAATTTCTACTCTTATTATTTATTTACAGCATGAGGCAATACAGGGAACAATTCGAGCACGAGATTCG GACTATATTTCCCAAAAAATTGTGCAAGGCAATATATACAATATTAGTAACTTTTATGTTACTGAAAATAAACCAACATA CAAAGTCGTTCCACATAGTGCTATGATTCAATTTGCACGAGCAACATCCTTTACTCCAATTATGGAAGACGCACCACACA TCCCATTTCACAAATTCTACTTCATAGAATTCGACCAGCTATATCAAAGAATAAATAATACTGAGATATTAACAGGTACT ATCTTACTTAACTTATTTTATTATTACTATAAAAATTTCTTGAATATTTATTTACAGAATTTTCCTATTTATATATAATA CTAGATGTTATTTGAGTATTAACAAGTGTCCAGGCACTCGAGCATACACATGTCAGCACTAGACCAACAACACGGCGATC CATAACAATACAAAACATCAGGTATAATAATTTCATGCTCTTTTCCCTCACATTTACTATTCATTACAACTATTTAACAT GAATACAATTTTTTCTCACTTTTATTGTCCGATTTTATTACTCATTTTTATAAACCACTTTTTGCCTACAGAAATGAACA ACTGCAGGTAAGCCTATGGGGACATAAAGCCGATCAGTTTGATGAGAATGTCCTTAAAGCATTAAAGGCACCAATTGTGG CTGTTCTTTCATCAATGTTGACAAAGCAGTATCTAGGTATTTTCAACATTACTTTATTTAAACTTCTTTATATACACATA TACAATGAAATAGCATACATTTATTATTTACTCTATTATATTTCAAGGTAACTCATATGTTTCGAGTACATCAGCACGAT CTTCTATATTGATCCAGATATTCCAGAAATAACAACATTAAAGACAAGGTAAACATACATGTATAGAAAATATATTCTAA TAAATTTATCATATTAAATAATAATACATTTTATTTATACTTTCCTGACCTTATTCATATTTTTATACGTACAGATTTTC CCATCAAAATCAACAAATTGAATTCCTACCACCCCTAAAAACACCTATCCAAACAATTGAAGAACAAATATCGGCAAATA GAAGAACAATACACGAACTCAAAATATTGGATGCACAAAATAATCTGGTTAGTACTATTAACTTTGCTATCATTTTTTTA CTATACTTAGTAAACAATTTTAAACAAAATTATTATCTCTTTTATACAGGGTGAAAAATTCACTGTGAGAGCAACAATAG TAAACTTCTCGACGTCTCAAGGATGGTTCTACAATTCTTGCCCCAGATGTTACCGATAATTAAAGCAAGCAAGAATAGGT TGGTGGTGCGACAGTCATGGCCATATAAAGTCAACGCCCTCTCCATGGTAAATAGATTTATTACCATACCCTTTTTATTT ATTACATATCTTTATTTGCTTTAATAAAAAAATAAAAACTTTACAAAAAATATACACATATATATATGTATATATGTTAC AGGTACAGATTAACAATTCAAATTGAAGATCATACTGGAGACATAGAAGTCATCGCTTTTGGCAGAATCGCGCAGACATT AATAAAAAAACCATGTTCTGCACTAACAATTAACGAATGCTTTACCGATCCATTTATAATACCACCAGCTATCGATCAGA TCCGAGGACAATCCAAAATCTTCCAGATCTTTTTTCAACAACGAGGCACCCAAATGAATACATTAATTTTCAAAATATTT GAAGACATCCATGTTCCATCATCGCCACCAAAACTATTAACTGCAGGAACAGAAGAACCACACAGGTAAATATTGTCTTT AAAATTTTCCAGCAACTATACATAAATAACATTTATATTATATTAATAACAATTTTAAAAATTTTCACATCTTTCAGCCC ACTAGCTATACCATCATCTCAGCTATCAACACCGGCCACATGTGATCCACACACTCCAACACCAAAAAAGCCTGGCACAA GGTAAATCACATTCAACACAACAAAGATTATCAATTTATTCAAAAACATATCTACAGATTATTCNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAATATTTGAAGACATCCATGTTCCATCATCGCCACCAAAACTA TTAACTGCAGGAACAGAAGAACCACACAGGTAAATATTGTCTTTAAAATTTTCCAGCAACTATACATAAATAACATTTAT ATTATATTAATAACAATTTTAAAAATTTTCACATCTTTCAGCCCACTAGCTATACCATCATCTCAGCTATCAACACCGGC CACATGTGATCCACACACTCCAACACCAAAAAAGCCTGGCACAAGGTAAATCACATTCAACACAACAAAGATTATCAATT TATTCAAAAACATATCTACAGATTATTCTATTCTTTCAGTCCTGAATCAAGAACAACAAGACAATCTACAAAACGCCCAA GAACAAGGTACTTTAAATATTTTTATAATACTTATTTCATACTATATAATTTAGGCACCTTCACTTCTTTTAACACTTAT ATTTACAACCGTTTTCCTTATTTTTATGCTTGCAGCTAAAAAAAAAAAAATGCTAAGAGACTACAACTTCTTTTTTTTTT TGTCTGTACATTCTGTATATATATAAATATTCTAAATAATAACACTATATATGTATGCATAAATATATTTATATAAATTT TATATCTATCATGTAATACAATATTATATAATACATGTATATATAAATATATTTTAAATACAACTACCATATAACATAAC ACTGCTTTCCGCAAGCTCGTTACATATACTAAAGGAGAGCTTCCGCCCACTGTTCATCTACACTCAATTTACTGTGCATA GTACAGTATTGTGACGTTTTTGCCCTTCTTTTGCACTTATTCTGTTTGTGGGCAGTGGGCCTTTTGGTCTTTTTGTGTCT CGGGATGTGGTTGAACGATTTTGTCCTTGTCTCCTGAGTTTTCTATTTCTTTCTGCCGTGGCCTTTCTTGTCCTTGCGCC CGTGTGGAGCCCTACGGCTCATTTCTTTCTTTGCATTTATGCTCTCTGCCGCTATTGGGCCCCTCATTCTTCTTTTTTTT TTTGGTCCTCTTCGTGTGATTCTTCTTTCTCGCTTGGTTTTGGTTGGGATATTGCGCCTCATCCTTTCAGGTTTTGGAGT GTTGATTCTATTACTGGGATTTAGGTGGAAATCTAGGGGTTTTATCCCTTTTCCCTTTTGGATTCTTCAGTCGTTTCCAT TCGTAGTTTATGATCTATTTCTCCTCTGTTCTTCGTTTATGCCTTTTTTATTTCTGCTTCTTGCTTCTTTGGTGGTTTGG TTTGCGTTCTTCGTTTTGGTTTCTACTTATATTTAATGGGTCTTGTTCTTAATTTGTTGCTATTACTCTTATTTATCTAT TTCTTCATTGGGTTTTTTTTCGGCTGCTTCATCTACTATACTTCTTTGTTTATGGTTGTTTTTAATTTTTTTTTCCCTTT TTTCCGCGTTTTTTCCCTTATTGTTTTCTTTGCTATAGTATTTTGTGCAGGTACTTTATCTGCGTCAGTGGATTTTCTCT TGGATGATTCAATGCCATGGATGGGTAATTTTTTTTATTTTTTCTACATTTATTGTGCTGATGATCTGATCTGTCTATAG TTGTCATTTGCTTTGCTGGATTGATGATTTGTTCTCCTTTTGTTACGGACATATTAAATGAATCGGTGATTTTTTTCCTT TGTATATTTTCTGGAATCCTCGCCATTCTCAGCTTGAATTATCTAGAATCCTTGGCAATTTAGGGAAGAAAAAAAATCTG TTACTTTTTAAAAAAATTTTAGTTTCTTAATTTTTGTAAGCTGAATATGTTTTATTACGTGTCATATTACTAGAAGTTAC CTGTTGTTCAAGCTAATTTTTCCATTTAATATTTATCAATACTGCAGCTTGCATACATTTGTGATACACGTTTCTGCCTT CATCTCCTGTACCTGTTATTTAATATTTATCTACTTTGTTTGCTTATCCTTTAACATTTGACTGCTTCTGTTCCTTTTTG GTTGGTTCATATCTTACAGTTAGAGCAGTTTGACAGCGTTTCAGGTATTATTAATAGCTTTTACTTTTTTTTTTCTAATG TTATTAATAGCTATTGTCTTTTTGCTTTAGTATTTCTGTTGATTTATGGTTTTAGTATTTTATTATGTTCTAATGGCATT GATATGTATACTTGCACTTTATTGATTTCTTAGTAACATACTTACATATATGAATTTATTTAAAATGTTTTAGCTTCAGC TTCTAATTTTTTTCCTATCTTTTTTTTTAACTCTGCGTCCCTTTCCTGTGCCCTCCCAATTTCTTCCCCCCTTCGTTTCC TTCGTTTCCTTCTTATTTTTTCTTTCTTTCCCCTCATGGCGATGATGAACAAGAATAACCTTGCTACGTTGAATTTGATA TGATTTGTCTAAAAATTGTTGTGGATGTATCATTTTCATTCCATACTTTTTTTTCCTCTACTTTCTTTCATTCAAAATTT TTGGCCGTTCCCTTTTTCCTATTTTTTCTCATTCTGATGTTTGCATTTTGTTAGGATTACTCTTTAATTTAAGACTTATT TGTGTGTGTGTGTGTGTTTAGTTTCCTTCTTACAATATTAAATCTTGTTTTTTTGCTTTGCTTTCTTTGCCTATGATATT TTCCCATGAGTTTATGTTATTACAAATCCCTAATATTTTATTCTCACCAATTCAATTGAGATTTATTTACTCATATAATA TGTTATTTTGTATCCTTTTCATCTTTGTTTTACCTTTTAACTTTCAATTGTGTACTAGGAATTATCTATTGCCAAGGCAG GTTCCTCTCATTGTGCATGATGCATTTTCCAATATATTTGTGTTTTCACTTCTTATTTCTTCTGATTTTCTCTCTCCTCT GTTTCGTTTTGAGCTATATCTTTTACCTGTTTTTTGTTTTCTCTCTGCTTCGTATAAGCAAGAGGATCCCTATTTTTTTT CTTTTCCTTTTCATCTACTGGTAGTTCTTGGACAACTTTATATCTTACTCTGTCTGGTTATTCTTTGAAACATACAGACT ATAATTTGTGTGATGGTCCAAATATCTTATTAATATTCATGCCTTTTATGCAGTTGCCCATAGTAGGTAGCCACAAACTA GCTAGAAGCATATAAGTTTATTTGTTCATCACACATTGATAAAAACATTTAATACCTGAGCCATGATTCCTGTATAAAAA TACTATGATGTTTATGTTTTACAAATTTTTTAGGCACTTTTTCCCCCTTTTTTGGTCACCTTTTCTTTTTTTGTTTATTT TTTTTCTTTTCTCCTTTCTCTTTTTCTCTGCATTTTTTCTTATTGAAATATCAATACAATTTTTTGTTCCCATGACTGTT GCTGATACTAAATATATCAATTTGCTATGCCATTGATAATATTGGTTATTTACGTCTTTTTATCTTTTCTCATATGTGGT TTGTCACTGTATTGATAGATACTGTCAATCTATAAGGTTGATTAAAATTTAATCCTATTGTTAGCAAATATTAGTAATAC ATTTTTATTTCATTCTTTGTTCCATAAGTAAGTGATCTATACTTATTGATTTCCTTTCCATATCTTTTTCAATAAATTTT TCTTTAAATAGCATTTTAATAAAATGTTTCCTTTTTCAATACCCGAGTCATGATCATTATATAAAAATACTGTAATATCT ATTTTTTTTCCTTGGTCTTTTATTTTGCCCTTTTTATTCTCCTTTCTTTCATGTTTCTTTGCTTTTCCACTCACTTATTT ATATCCATTTTTTCAAGTTTCCTATCATCTATTGCTTTGCATTCCTATTGCTTTATCCTTTTTTTCGAGATTCGGCCTTG GTTGGCGTGCCTCTCCTATTCGGGCTGTTATTTACATGAATGAAGTGTTCCTAAAAACTTATATTCATACATTTTTAATA AATGTTGCTGATGATAGATGGTGTAATTTTTTATAATATTATTAAAGTGTGAAGTTTGTTCAGGATTATCTGCATCCATA TAAGCTTATCTTACATTTTAGTGAATATTTTCGTTCATAAATAGGTAATTATGGTATATTAAGTGTTTTCTTTATCATTT CCTAATTCATAAAAAAACTTGTACATGTATATTGGCGATGATGATCATACTCAATTTTCATGTTTTTAAGTTTGTTTGAT TTGTCTAAAAAATGTTGTGGCTATGTCTTTCCTACTTTAGTTTTTACTCAACCTATTTCTTTGTTCTTTGCCTTGCCTTA AAGTTCCAATTTACTTATTCATGCTTCTCCTGTTCTCCCAATTTACTTATTCATGCTTCTCCTATTCTGTTCCAATTGTC TTCCCTTTACCATGCCTTTGTCTGGCTCAAAAAAATTTATAAATCATTATTACTATTCCATATACTAAAGGAGAGCTGAC ATTCACTATTCATCTACATATATTTTACTCTTTCTTGTACAGTGGAGTGATTCATTTAATGACTGATTGCATGGAGTGAC GGCTTTGCCTTTTTCATTTCCTTTTTCTATGTGTGGGTGCTAGGTATTTTAGTCTACTTATACTTTGAGTCATACATGGA CACTTTTGTGTCTGTCTTTTTATCATTCCGTTTGTCTTTGTCGTGGGCTTCTCAATCATTTTAGGAATGTAGAATGTTAA CATCTCCTCCTTTCTCAAACTTCTGTCCTCTCTGCCATCTTCATTTTTTCTTTTTCCTCCTTTGTCTTCCTCTGATCCAG TCATTATAGTTAAATTTTTTAATATTTTCAGTTGTATATGAACACTTTTGTTTCTGTTTTTTATGCCTTATGTGGTCGGC TTCTCAAGCATTTTAAGAATGTAGAATGTTAACATCTTTACTTCTCCTTTTTTGGTTCAAGTCACTGGTGATTTTTAGAC AAATCAACATCTTATTTTTACAAAGCATTACTTAAAATGTGTTACAACTAATATGATAGATATAATATTGCACCAATGTT TATGCCTTTGTACAATGTAAACAAATTTATGTTACTATATTGTACATATTTATTTACACACACACATATATATATATATA TAAATTATTTTTCCTTTTATATAATACAAAAATATTACCCATAGTAAAGCGCGGGTAACAAACTAG