>DHH_19_1_Mno length=8655;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCAATTATAATATAAATGTATTATTAGTAATTTTTTTCGTTTTCTGAATTTACATTTTTATTATATAATCCATTTATTAT TTACAGATTTGTAATATATTACATTTATTTGAAACAGATTTGTTGTTTCGTTGTACTTTCTACCGTCGAACACAGATTTG TCTAGCATTTGTGTATGGTTGATACTCCAGTTGTGCTTAACTCTCTCAAATAGAAACGTGCGTTTTGTAACGACAGAGAT AAGTTTTTAGTGTTTAATTCATACGTTATTATTATTCTAAATTTATTTAAAGTATATTTATTAACATATATAATACATTA ACAAAATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTATACATTTGAATATATGTTTA AATAAATATTTGTTAGTTATAGAACATAAACATGTTATAATGTTTATTACATTATAGTTTTAACATACATATTTATGTCA AAATTTTTAAAAAAATGACCTGCTAAAATGTTTCATCATAATTAAGCATAAAATACTTAAATATATATAGAAACAATAAA TAAATATTCAGCAATAAAATTTTATTAATAATTCTACCAGTTAATAAAATTTTTATACAAACATAATCTAATTGTGAATA ATATATCATAATTAAAATTAAATATATTTTAACATATGATAAGCGTTGTTATTTACAATTATAGAATAACTAAATAACAA TATGAAACTAAATATTTATCCTTATAAATAATATACAACACATTTTAACAAATCATTTTTCTTTTTACTTATAATAGGTA AGATAAATAATTAGACTACATTTTTAAATTAAAATTTCTAAAATGATAATTCATTGTTTAACATTTAGACTAATTTATAT TTAACAAATATATAATTTATTATATTATAATTGTTTACGATATAATTTACAGATAATGAAAATGAAAAGAAAGTTAAATG AAATTTATCCTCATCAAAAGAAAACCGAAGGTGTCAAAAATAGAAAAAGAAGGACGAAAGAAATGCATCAGTCAGGTTCA GAAATTATAAGGACACATCGAACCAAACATACACAGTTTTGTGGAACTTTCACCAATATTGAGATCCCTTTAAAGTCAAC AATTCAACACTCAAAAACAACGCTGGTTCAAGAAAGTAATTCCTAAACTTAAAATCTTTATTTTTAAATTTTTAACGCGT ATATTTTCAACTAATTTAAAATTATTTTTGAAACTATGAAATTAGGTGATCTTAATACATATATTGATCTAGGAGATTGT GAGTCGACATGTGAACATTGTGGAGCAATATTTTGGAATAATGAACAAACTGAAAAATATCCATATAAATATTCTTCATG TTGTCAGAATGGAAAAATAAAATCACCTTCCAAAAGAAAAACACCATTGATTTTAGATGATTTATTAAACTATTATGGTG GAAGTCTAAGTACACATTTTAGAAAAAATATACGAACATATAATTCAATGTTTTCTTTTACATCATTTGGGGCAAACATT CAATCAAATATTAATGAAACATTGGGACCCTATATATTTAAGATTAGTGGACAAACACATCATTTAATGGGATCTTTACT TCCAGTTGATAATAATCCTCTAAAATTTGCACAATTATATATTTATGATACATAAAATGAAATTCAGAATAGAATGTCAA TTTTTACATCAATGAATAGTTCAAATTCTTTAAATGAAACTATTATTAAAAAATTAATAATAATGTTAGATGAAATAAAT ATATTAGTTAAATTATTTAGATTTGTTAAAAATTGTTACAACACTGATAAAACACAGTTAATGAAGTTAAGATTAATAGG TAGACGAGATGAAGATGGTACACAGTATGACCTTCCAACCTCAACAGATATTGGAACTTTAATTGTTGGTGATATTGGTG AATACGAAAAAGGAAGATATATTATTATATGTAATCAAACAGGTGACCTACAAAGAATTAATAAACTCCATCCATCTTAT ATGTCATTACAATATCCTTTATTGTTTCCTTATGGTGAATATGGATATAGACCTAATATAGGATGGAATCCTGAATTTAT AGGAAACAACCCATCTAAAAAACGAATTTCAATGAGATCATTTTATGCTTTTCAGTTACACCAACGTTTAAATGAAGGAA ATACATTATTTAAAAGTGGTAGATTATTTCAACAATATATTACAGATGCCTATGCTACTATTGAAAAAGATCGATTAGAT TTTGTTAGACATAATCAAAATAATTTGAGATCTGAATTTTATAAAGGTATTCAAGATGCTATAACTAAAGGTGATACTGA CCCTCAAACAATAGGAAAAAGAATTATTTTACCATCATCTCATACTGGAAGTCCAAGATATATGATTCAAAATTATCAAG ACGCAATGGCAATATGTAGATATTATGGAAACCCTGATATTTTCTTGACATTTACATACAATCCTAAATGGCCTGAAATT ATAAGAGCTTTAGCTTTACTTCCAGGACAAAAATCTAATGATAGACCATATATCATAAGTAGAATTTTTAAAATAAAATT AGACCATTTATTACATACAATAAAATCAGGACAGATTTTTGGAGCCAGAATAGCAGGTAAATTATTCCATTTTATTGTAC TCTTTTATATTCTATTTATTTACTACTTGGAAAAAAAATATTTACATTTATTTAAAATATGTTACTATTTTTTTTGTCTC AATGTTTTTTTCTATTATTGTAGATTTATACGTTGTCAAATTCCAAAAACGTGGTCTTCCTCATTGTCATATGTTATTTT GGTTACATAGAGAAGATAAATATCAAGATCCAATACAAATAGATAAAATTATATCAGCAGAAATCCCAAATCCAAAATAC GATCCATTAGGTTATAAAGTTGTTATTGATTTTATGATACATGGCCCATGTGGATATGCAAAAATAAATGCTCCATGTAT GAAAAACTCAACATGTACAAAAAAATTCCCTAAACAATATAAAAATGAAACAAGCATAGAAGAAAATGGTTTTGTTAGTT ACCGATGTAGAGAATCTACTTTGAATACTATTAAAGAAGGAAGACAACTTGATAACAGATTTGTTGTGCCATATAATCGT ACATTATGTATAAAATATCAAGCTCACATCAATGTTGAAATATGCTCTCAATCAATGCTCATAAAATACTTATTTAAATA TTTAACAAAAGGACCAGACAGAATAAGAGCAATTATTGAAGATATTAACATTACAGATACTACAAAAGAAACAAATACAA AAGAAATTGATGAAATAAAAACATATCTTAATTGTCGATATATTACACCCTATGAAGCAATTTAGAGATTATTTGAAAAC CCAATACATCATAGAAATCCAGCTATTCAACTACTTACAATTCATTTACCAAACATGTAAAACATTACATTTAATAAAAA TCAACAATTACATAATATAATTAATTTACCTCATAACAAAAAAACAACGCTAACTGAATGGATGGAAATTAATAAGATAC ATGAAGAAGCTCGAGAACTTACTTATATAGAATTTCCAACAAAATGGGTTTGGAAACACAAAGATAGAATTTGGACAAAA CGACAAAATGGACATACTATTGGAAGAATGTTTCATATTCCTCCCAGTTGTGGTGAATTATTTTATTTAAAATTACTATT AAATCATCAAAAAGGTGCAACAAGTTTTGAATCAATTCGAACAATTAATAATACTATTTATCCAACATATCAACAAGCCT GTCATGCATTAGGTTTATTAGGAGATGATAAAGAATGAAATGAATCAATTGAATAAGCATCATGTTGGTCAACATCTACT CAACTTCGTCAATTTTTTACTACCATTTTATTATTTGTAATGTATCTGACCCAATAAAGTTAATAGAAAATCACTGAAAC TTAATGTGTGATGATATTATATATAAATTAAAAAAATTATTCAACAATTCAACATTTCAAATCCCAGATAATGAATTATA TAATTTTGTATTATACGATTTAGAAAAATTACTAAATTTAAATGCATCTTCTTTAACAAATTTTAACATATGACTTCCAA CAGGATCATTAATTGAAGATTTAGATAATAAAGTTTTAAGAGAAGAACTCAATTATGATAAAAAAAACTAAAAGAAGAAA ATATAAATTTAATAAATAATTTAAACCATGAACAATATTATATTTACAATGAAATTTTAAAAGCACTTAAAAAAACCTGT GAAAAATTATTTTTTGTATATGGATATGGATGTACAGGAAAAACATATTTATGGAATACACTTATTAACAAAATTAGATC AGAAGGTGAAATAGTATTAGCAGTTGCATCATTTGGAATAGCATCATTACTTTTACCAAATGGTCGTACAGCACATTCAC GTTTTCGTATTCCTCTTTTAGTTGACAAATTTTCAACATGTCAAATTAAAAAAAATACTCAATTAGCAAATTTAATAAAG AAAACAACTTTAATATTATGGGATGAAGCGCCAATGAATAATAAATACTGTTTTGAAGCTTTAGATAAAACAATACAAGA CTTGAGAAATAACTTTAGTCAACCTTTTGGAGGAATGACAGTTATTTTAGGTGGTGATTTTAGGCAAATTTTACCTGTTA TTCTAGGAGGCACAAAAGAAAACATTATTAATGCAAGTATTAATAATTCTTATCTTTGGCCATATTTCCGTGTACTAACA TTGACAGAAAATATGAGATTAAAAATTCCAAACAGTTCTATTGATGAACAAACTGAAATTAAAAAATTTTCTGATTGGAT ACTAAATATCAGAAATGGAACACTTAATGGAATAAAAGATCCTGAAAACGAAGATGCTACTTGGATTAATATACCTGAAC AATATTTGATAAAATATGATAAAAATCTGATTGAACATATTTCCACTATAGTATATGATGATTTTAAAAGTAATTATGAT AATATTAAATATATAAAAAATCGTGCAATTGTAGCACCTAGAAATAAAACAACAGATGAAATAAATGATTATATGTTATC TTTAATACCTATAGAGGAGAAAATTTATTACAGTTACGATACAATTATTTTCTCATCTGGAAACCTTGATGAATTAAATC TATTATATCCTCCTGAATTTTTACACACATTAAATTTTAATAATTTACCACCACATGAATTAAAATTAAAAATCAGAATT CCTATTATGTTATTACGAAATCTTAATCAGTCACAAGGTTTATGTAATGGTACTAGATTGTTAATTACCCAATTAACAAA TAGAATTATTGAAGGTCATAGTATTAATTCTATTGATACAAATATTAAAGTTTATATACCTAGAATAGAATTAACTATAA ATGAATCCAAATGGCCATTTGTTTTAAAAAGACGACAATTTCTTGTAAAAATATGTTACGCAATGACAATAAAAAAAAGT CAAGGTCAATCATTAGAAAAAATTGGTATATCCCCAAAAGGTTTAAATATTTTAATACATGAATCAATAAACAAATATCC AAATTATATCAAAAATATTGTATATAAAGAAATATTACATAATATTAATAAAAATTAATCTACTTATTCTTTTATACCAA AAATTTTATAATGTATATAATCTCACAACATTCAACAAAATCATTTTCTAATTTTTAAAGTATTATTGTAAATTTTTATA ATATAATATTCTTTTCCATTTATATATTATAAATTTTAATATCTTTTATATTATTTTACAGTTTCAACAAAATGTTTGCA CCAATAAGAATCTTGAAACCTAGTGAAACACACTTGACTATTCATGCTCGAATATGTCGTGTATGGAGAAACGTACATTT ATATATTATGAATTCTTATATTTTCTATATTATTTTTCAGTTTGAACAAGATGTTTGCACCAATAAGAATCCTAAAACCT GGTGAAACACACTTGACTATTCGTGCTCAAATATGTCGCTTTTGGAGAAATGTAGACTACAAGACAGGAGAATTTATCAG TCATGATAGACTGTTGGTTGATGAAGAGGTAATCAAATATATTCTTTCTATACATTATATAATTATAAATATATAGAAAT ATATATACTTATTATTCAATTTATAACAATTGAAAATCTAATTTGTCATTTTACAGCACGAAGCAATACATGCAGTTATC CGATCAAGAGATGCTGACTACATGAGTCAAATAATTGAAGAAGGAAATATATATGAAATTAATAACTTCTTCATCGATCG TAACAAACTAAGATATAAAATTGTTCCTCATGTGGCAATGTTGCGGATAGCTAGAGCAACAATTTTCAAACACGTTCCTA TGACATGCCTGAAATACCTCAACAAAAATTTACTTTTGTCGAATTTGATCAAATTACTCAAAGGATCGATGTAAACGATA TTCTCTCAGGTTTGTTTATTTTATTACTTATTTACTTATAATTTTTAATCAATTATTTCTCATTTTATAATTGTTAAAAC TAATTGATTATATATGTAATATTTGTATCAGAGGTAATTGGTCAACTCATATCCTTCCATGGTATTGAAGAATTAGCTAT CAATGAAAGAATTGTCAAAAGAAGAAGTTTCACGATTCAAAACATAAGGTAAATACAATAGAAATTATTATTATAATAAT AAATGATAAAAAATATTCATGTTTAAATATTTATAATCATGTTTTCCATTACTTAATACAGAGAAGAACAACTAAATATA ACGCTTTGGGGAGAAATGAGAGAACTTTTCAATGAAACTGTTGTGCGGTCAATGACGGAACCAATTGTTATTGCTTTTAC AGCAATGGCGGCCAAACAGTACCAAGGTTATTACTCATATTATAATATATTATATTCTAATTTTTTACAAAACTAACTAC AAATTTCTATTTATTACAGGAGGTCTTTATTTATCAAACACATATGGTACTTTTTACTTTTTAGATCCAAAAATTCTAGA AACACGAAGAATTAAACAAAGGTATAACAAAAAATACTCACTTTTCTCAATGTTGACATATATGTATCTTCTCATTTTCA TTTATTAACATAAAACAAATTCTTTTTATATAGATTTCGTCATTCTATTCAGAATTTGGATTACGTTGCTACATCAGCGA GGCCAGCAATATCATTAGAAGACCAAAAAAACACAAATCGCATTACCATCGCAGAATTACGAGCATTAGATGCATTCTAA AATCGGGTACAAAGTTTATAAATATAATCCATTAAATATAATATGTATATATATTGAATTAAACTGTTCTCTTTTCTACA TAACAGGAAACAAAATATACAGTTAGAGCAACTATAACTGACTTATATACACATCAAGGATGGTTTTACTATGCCTGCAC AAAGTGTTACAAACAAGTATAAGAATCTGGAACATCATGGTGGTGTGACACTGATGGATATCTATCTACAATGCCACTTA CTTGGTAATAAATTCTATTATAAAAAATAAGCGCTTTAATTTTCTATTAACAAATACAATAAATATAATTTAATTTTCTT ATACAGGTACAAAATAAATATACAAATTGAAGATAACACTGGAAGAACAGACGCTGTAATGTTCGGTAAAACTGTGCAAT CACTTATTAACAAAGCTTGCTCTACACTTACTTATGATGAGGGATACACTGATTGCTATATGATTCCTCCTATTTTAAAG GAAATAAGAGGAATATCAAAAATATTTGTCATATAGTTTCGTACTTATGGAGCTTTTATTGATAAAGTTATTTTGAAGAC TTTCAACGACGATCAACCTCAGTTGTATTTACCACCTATAACAACTGAGTCTTCAAAAGAACATCATCAGTTTCAAAGCC AATTCAGTCTGTTTCAGTCCCTCACGAATCTACCTCTTTCACAAGTTCATCAAAAAAAAGAAAACAAATCAGGTAAAATT ATGTGTTATATGTGATATTAAATATTTTAATAAGTATGAACACATTTATTAACAATTGTTACAATTTAATAATATTTATT TCCTTATTTTCTTCCTTCTTATCTGCAGCTCAAAAGAAACGACAAGCGAAAAGAAAAAGAAATGATTATATGAATAAATC TCTATATATATGTAAATAAGCATGTATATTTTTATGTACAAATGTAAACATATAAATAAATATGTATATATATACATACA CATGTTACAGATGTACAACTTATAAATATATATATATGTGTGTTTTTATACGTTTTATTTATTTAAATTATTGTTAATTA CACTATTACGTACCCGTGCATTTGCACGGATACTCCACTAGTAACTACTAGGGAAGGGAGGCAATTACACTATTACGTAC CCGTGCAAATGCACGGATACTCCACTAGTAACTACTAGGGAAGGGAGGCAATTACACTATTACGTACCCGTGCAAATGCA CGGGTAATCCACTAG