>DHH_18_1_Mno length=8851;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATATATATACACACATTACTTGATTTTAGCTACAAATAACTTTTATATTTTTCATTGATTTACATATTTTACTCTAA TAATTTTTGAACTATAGCGATGATGATGTCACAGAATGTTCATATTCCTCTTTCATCATATAGATTGTCCAAAAATTACT GTTGAGTATATTAGCCCTGTTTTGAATCAACTTTTTGCCTAAATTTTGTTGACTAAAACAGTTTCCTTTTTCTTTCCAAT GTTCTCCTTTACTTAGACTTATTCTAATATCATTGGTATTTTAATCTTACAAAATTACTAATAATTTTATAATTTACTAA CCATAACTATTATTTTAAATAATCTACAGTAGATTCTTCGGAGGTACTGTTCACTGTATAGTGTTATGAACAATAATTTT TTCTTTCAGTCTGTCAAATGTATATTCACTGATTTCAGAACACTTTTTACATAACGTTTTTTCCCATACATATGTTATTG TCGTTTGTACATATTTTTTCAAGCTGTCCTATTATTTTTCTCAGAAATAATCTTTTTGATTTAATATTTGTACTATTTTA TATATGTTTTCCCCTGTTTCTATAGTATCACTTGGTAGTTTTTGGACAATCAAAGATTTTGCTGCTGTTAAATCTTTCAT ATTTTTTTCCCTTTGTCGTTTTGATTTATGTGACACATATAATGTTTTAATATATTTTATGACTTTGTGCAGTTGCCGTA AGTGTTTTTTTCTCATCTAAAAACACTTGCATGGATAGCTACATGAGTATTATATATTATACTCTATTATATTTGTCACA TAATGCTGAAAAAAGCTTACACCTGAGCTACAGTTATTTCATAAAATTTTATAAAATAGTTTTTAATGTAATATTTTGTT TTAAAATATATTTATACTTTTTCCATTTATATAGTTTAATGTTTTGTAATATTTTATGGCTTATGTTTAATAAATTTTCT TACTTTATTAGGTTTATGTAATTATATTACATTACAGAATAATATCATATTGTTGCAGCATCTCTGAGGAAGAAATTAAT TATATGTATGTATTTACTTTTGTATTCACATATTATTTTTATTATTTTATCTATTTTATTTATTCAGTTTATTGTTCATA TTTGTAAATATTTTATTCTTACGTTTATAAATATGCATCAATTGTATATTATTGTACATTTGTATAAAGAAATTATTTTG TTCACTTAGGACTTAATGCCAAACAATGTTATAAAGTTATTCATTTGTTCAATTAATATGTTTGCACAAATATTTATGTT ACATGCTTAGGTTTAATTTATATATAAAAACTTATTGGCTACAAAAATTATACATATAACGTTGCAATATAAATAACAGA TGGATAATACAAAATACCCAAAAAAATCTATACAATCAAAATACCGTATGCGGCGCATCATTCCACGTACGGACCAAATC TCAACAACTGAAGATGTCAAAACTTCATTTACAACAACTTCCCGATCAAGAGTTGATGCAATGCAGTCACTTTCCCACCA AACTCAAGTAGACACACGCAACCTAAGTACTCCATCAACATCCGAAAATCAAAATAACAAATGTAATTATTTTAGTTACA TTAAATTTTAAACTCTTATTAATTGAAAAATGTAAAAAATTTACTTATTATACTTACAGGTTCTTTTCCTTTTTATAGGT ACTTCTAATATTTATGTAGATCTTGGAAATTGTTCTTACATTTGTCAATACTGTGGTGCATTATTTTGGCTTAATGAACG AATAAAAACAACAGGCACTCCTAGATTTAATCTTTGCTGTAAAGGAGGAAAAATTAAATTGCCCCAAACCAAAAAAACAC CTCCAATATTAGATAATCTACTTGATTATTATGGAGGACCAATAAGTACACATTTTAGAAAAAATATTCGAATATTTAAT TCTATGTTTGCATTTGCATCATTTGGAAGTAATATAGAAACAAATCAAAAAAATTCAAATGGTCCTTATATTTTTAAAAT AAGTGGACAAATTCATCATCTTATAGGATTTCTTCTTCTAATTAATAACAATCCTCCTAAATTTGCACAACTTTATATAT ATGACACCGAAATTGAAATTGAAAATCGTATAGCAACATTTTCATCTAATGATCAAACAAAAGAAATTATTAAATTAATA ACAAAAAATTTAATTATAATGTTGGATAATACAAATAATTTAGTGAAAATCTTTCGAATGATACGAGACAGATATAAAGA AAATAAAATACCATCGATGAAATTAAGACTTATGAATCGAAGATATACAGATAGTAATCAATATGAATTACCAAATTCAA GTGATATAGGATGTTTAATAGTTGGAGATATTGGTGATTGTGAACAAGAAAGAGATATTATAATCGAAGAAAAAACAGAT AAATTACAAAGAATTACAAAATTACATCCATCTTATATGGCTCTTCAATATCCTTTATTATTTCCTTATGGAGAAGATGG TTTTAGAACTGATTTAAAATATAATATAAATACCTCAAATAACAAAGGTAAAAGAAAAAGAATATCTATGAGAGAATTTT ATTGCTATCAACTATTAGAACACAAAAATGAAGGAAATACTCTTTTTAGAAGCGGTAGACTATTTCAACAATATATAGTT GATTCATATGCCTCTGTAGAAGAAGGTCGATTAGACTATATTAGACAAAATCAAAAAAATTTAAGATCTAAAATTTATCA AGGTATAAAAGATGCTATTACTAAAGGTGACACAAATGCACAAGCAATAGGAAAAAGAATTATTTTTCCTTCCAGTCATA CAGGTAGTCCTAGATATATGATTTAAAACTATCAGGATGCAATGGCAATTTGTACACATTATGGAAATCCTGATTTATTT ATAACATTTACATGTAATCCAAAATGGCCTGAGATTACTAGAACCTTAGCAAAAATACCAGGTCTAAAAGCAGCCGATAG ACCATATATTATTACAAGAGTTTTTAAAATGAAATTGGATCATTTTTTGTCCACTGTAAAAAATGAGAAAGTATTTGGAA CAATAGTAGCAGGTTAGTGTATTTTTTTAAGTGTATTTTTTAATATAAATAAATAAAATATTGTCTAGATTCTTTTAGAT AATAACTAATTTAAGTTTTTTTCCCATTTTGTAGATTTATATGTAATCGAATTTCAGAAACGCGGTTTGCCACATTGTCA TTTCCTCTTTTGGTTACGTGCTAATGAAAAAATACGAGAACCATCTGAGATTAATAAAATTATATCTGCAGAAATACCTG ATCCTAAAAAAAACAAATTAGAACATAATGTTGTTGCTGAATTTATGATACACGGACCATGTGGAATTGCCAAAACAAAT GCTCCATGTATGAAAAATACAGAATGCTCAAAAAAAATTCCCAAAACAATTAAAAAATACAACAAGTATCGAAGAAAATG GTTTCATCATTTATAGACGGAGAAATACAGGCTTCTATGTTGAAAAATAAGGTATTAAATTAGATAATAGATTTGTTGTT TCACACAATACATATTTGTGTCTCAAATATAATGCCCATATAAATGTAGAAGTTTGTTCTCAATCAATGCTTATAAAATA TTTATTTAAATATTTAACAAAAGGATCAGATAGAATAAGAGCAGTTATAGAAAATAATATATGTTCTGAAAATTCAGAGC AAATAATTTATCAAGAAATAGACGAAATAAAAAACTATATTAATTGTAGATACATAACAGCATATGAAGCATTATGGCAT TTATATGAATACCCAATTCATCACAGAAATCCAGCTATTCAACGTCTTGCAATACATTTAGAAAAAAAAACAAAATATAA CTTTTCGCTCAACTCAAAATCCTAATGACATATTACGAAATCCAGATATTTACAAAACAACTTTTACTGAGTGGATGGAA ACAAATAAACGTGATATTAATGCTAGAGAACTAACTTACAATCAATTTCTAAGTAAATATGTTTGGAATAATAAATATAA ATATTAGACTCATAGACAGATAGGACATACAATCGGAAGAACATATTATATTCATCCAAGTTCAGGAGAATTATATTATC TAAAATTATTATTAAATCATCGAAAAAGAATTATAAGTTATGACCATCTTCGAACAATTGACTACATAATATATCCAACA TATCAGGCAACATGTTTTGCATTAGGTTTACTATGAGATGATAAAGAATGGGATGAATCAATATTAGAAGCCTCATTCTG GTCAAGTTCATCCCAACTACGCCAATTATTTGTTATAATCTTATTGTTTTGCAATGTAAATAATCTAAATAATTTACTTA AAAAACATTGGAAACTAATGACAGATGATATATTGCATAAAACTAAAACATTATTTAATAACCCGTATTTTGAAATTCCT GAAAATGATTTATATCATTTTATATTATATGAACTAGAAAAATTGTTAAATTTAAATTCATCAACACTAGCCCATTTTAA TTTACCGCTTTCAACTGGCTCAATACTAAATGATCTAAACAACAAATTACTAAGAGAAGAACTCAATTATGATATAAATA AATTGAAAAGAGATAACTCATTATTAGAATATAATCTAAATAATGAACAACAATTTATTTATCAACAAATCTTAAAATCA CATAAAGATAGAAAAAATAATCTTTTTTTCATTAGTGGTCATGGCGATACTGGAAAAACATATTTGTGGAATACATTAAT TACAAAAATTAGATCAGAAAATGAAATTGTTCTTGCTGTTGCATCATCAGGAATTGCATCATTATTATTACCTAAAGGAA GAACTGCACATTCTAGATTCTGAATATCATTATCAATAGATAAATTCTCTACATGTCATATTAAAAAGGGTACCCATTTA GCACATTTAATTGAGAAAACGTCATTAATACTATGGGATGAAGCTCCTATGACTAATAGATACTGCTTTGAAGCATTGGA TAAAACACTACAAGATTTACAAAATATTTTTGACCAGCCATTTGGTGGTATGACAGTTATTTTAGGAGGTGATTTTAGAC AAATATTACCTGTTATTCCTACTGGAACAAAAGAACATATAATTGATGCATGTATAAATAATTCATATTTATGGCCACAT TTCCGTATCTTAACACTAACAAAAAATATTAGATTACAATGTAGCAACCAAACAGAAATAGAAAAAAAAGAAATTGAACA ATTCTCAGAATGGATATTAAATATTGGAAATGGAACAATAACAGGAATAAAAGATTCAGAAAATGAAGACATCACATGGA TAGAAATACCTGAAAAATACATTGTACATTATGAGGTAGATCCAATTAAAAAAATCTCAACATTTGTATATGACAATTTC CTACGAAATTTTAACAATATTGAATATTTAAAACAACGAGCAATATTAACACCTAAAAATAAAACAGCTGATGACATTAA TGAATATATACTGTCTATAGTACCTAATGACCTAAAATCATATTATAGTTATGATACAATAATATCTACATCAGACAATA TAGATGAATTAAATCTATTATATCCACAAGAATTTTTACACACTTTAAACTTTAATGGTTTACCAACACATGAATTAAAG CTAAAACTTGGAACTCCAATCATGCTATTAAGAAATCTAAATCAATCCATTGAATTATGTAATGGAACAAGATTAATTAT TACACAATTAACAAATAAAATAATAGAAGCACAAATCATAAGTTCTAATAATATTAATGAAAAAGTCTATATCCCAAGAA TTGAACTTACTGTACATGAATCTAAATGGCCATTTACATTAAAAAGACGACAATTCCCTATAAAAATTTGCTACGCAATG ACAATAAATAAAAGTAAGGGACAATCTTTAAATAAAATTGGAATATATTTAGAAAATTAAATTGTTACTCATGGTCAACT ATATGTTGCTTTATCTAGAGTAACAAATCCAGAAGGACTACATATACTAATTAATGATACAAATAGTATATATCCAAATC ATGTAAAAAATATTGTTTACAAAGAAATTTTACATAACATATTATAAAAATATAAAAACTCTAAATTTACCTAATTTATA ATATTCTTTTTCTTTATATTACCTAAAAAAATAATATCATTATTATAATAATGTATACAATATATTTATTCAATCTTATA CTAAATAAATTGTTTATTGATTTCAACAATAAGATATGATGGCAACACCAATTCGAATACTGAAACCAAATGAAATCTAC GATACAATCAAAGTAAGAATATGTCGCATGTGGACAAATAATGATTTCATTACAGGACGCCTGATAAGCCTTGATTGTAT TTTGGTTGAGGAAGAGGTAATAGTTTCTATAAATTTTTCATTACAATTATCTTAAATACATATTTATTGTATTTGAATAA TAATATATTTCTTTTTTTACAGCATGAAGCAATACAGGGATCAATTAAATCACGTGATTCTGACATTATATCTCAAAGAA TCCAGCAAGGCAACATATACATCATTAACAACTTTTATGTTGCTACAAACAAACCAACATATAAAGTTGTTCCACACAAT GCAATGATTCAATTTGCACGTGCAACATCTTTTGTTCCTGTTGTAGACGAAGCATCACCAATTCCATTCCATAAATTTTA CTTCACTGATTTTGATTAGCTACAACAAAGAGTTCATACTACTAAACTTTTAACAGGTAATATACAGTGTTACTTTAAAT ACAATACCACATTTTATTTTTAAATCTATTTTTTTTTCTTTTATATTAGATGTTATTGAAGTTATAACAAGTATCCAAGC ACTGGAACATATAGGTATCAACAGCAGACCAACAACACGACGAACAATTATGATACAAAATATAAGGTACATAAATTTTC CACACATTTTATTTTACTTTCAATAAAAAAAAATCCTTAAAAAAATAAAAGAAAATATATCATCATCATTTTAAATATCT ATTTCTAAATGTTGGAACATTTTGTTTTTACTTTTCCAACAGAAATGAACAGCTTCAGGTTACCTTATGGGGAAATAAAG CAGACCAATTTGAAGAAAATATTATCAAATCACTTCAAGCTCCCCTTGTAGCAATTTTTACCACAATGTTGGTCAAACAA TATCTAGGTATGTTTCACATCACTTTATTATTATTATTAAACATATTAATATAAAATATATATCGTTATATTAATAATAT TGATGTTAATATCTTAGGCAATCCATATGTTTCTAGCACTTCTGCAACAATTTTCTACATCAATCGAGATATTCTTGAAA CTACTACATTGAAAACAAGCTAAAATTTTTACTATAGAATATATCTCTATACATATTATTTACAGTACAAGCTTAAATAT TTTATTATTTTTTATATCATCAATTTATTACATATACGCAGATTCTCTCAGCAGATCCAAGAAATAGATTTCCTACCAGC GCCAAAAACACCAATCCAATCCATTGAAGAACAAAGAATGGAAAACAGGAAAACAATAACTGAATTACAAGCATTAGATC TTGAAATCAATCTGGTTAGTATTATTAAATATTATCCTCTTTTCTTTTTCTTCTATTTTAAAATTTTAACTAATTAATAT TCTCTTACATATATAGTCCACACGATTCACAGTACGAGCTACAATAATAGGAATCTTAACAAATCAAGGCTGGTATTACA ACTCTTGCCCCACCTGCTACCGACAATTAAAGCAATCAAGAATTGATTAGTGGTGCGATAGTCATGGTCATATCAAGACA ATGCCATCTCCATGGTAAATCACCATATTTATAAAACATTTTATATTTATATTTATTCTCATCAGTTACAATAAATTACT TATCACATTTATTAACTTTGAATATATATATATATATATATATATATTACAGGTACAAATTAAATATCAAAATTGAAGAT AATACTGGAGATATGAATATTACTATATTTGGCAAAGCAGCACAAGCACTGATTAAAAGGCCATGTTCTGCATTAACCAT TGACGAAGGATATACTGATCCATATGTAATTCCACCAGTCATCGATTTGCTCCGTGGACAGACAAAAATCTTCCAAGTCT ACTTTCAACAAAGAGGCCACCAAATATCAGTTGTTGCATCCAAAATATTTGAAGATAGCCAATCTCCTTTACCACCAAAG AATATGCCAACAACATCAATTCCTGATACACAAAGGTAAGTCAAACTTATCAATATATATTTAATATGTAAATACAATTT TTAATAATCATAAATAAATCTGTAAAATAATTTTTTTGTCTTCATTTCAGCCATGAACAAACAAGTCCATCACTTATATC ATCAGCAATGACAATCAATCCACAAACTCCAATTCCCAAAAGAGTAGGTGCAAGGTAAAACATATTTACTATAAAAATTA CTCTAAACATTTCTAAATCTACATCTAAATAATTATTTCTAATTTCAGCTCTGAATCAAAGTCAAAAGAACATTCTACAA AACGCCAAAAGAAAAGGTAATAAATTTTTTTTAACATCTTCTATTATGCATTATCTATATGAATACTTTGTCAATCTCCT TATATATTGTATTGACTTTTTTTGATCTCTTAACATTTTTATCTTGCAGTTAAAAAATACAGGACATTGGATCTGATGGG CATTACTCTACTACAGTGTATATATGTCTATATGTGCATATAAATATATTTCCAACTACCATACTATATGTATATATACT TAGAACTATGTTTGTAATATTAATAGATGTTTTACATATATACATATCTTTGTAACTATGTTTTGAATAATATAAACTCT TTTATACGATACAACATGAAGATCCACAGCAACGCGCGGGAATTCCACTAG