>DHH_17_1_Mno length=8982;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATTTATTATATTTTATTAAGTTATTTCCGTATTTATCATATAATCCTGGTTTTCAGTGTACAAATGACGCTGGTCTT TTTATCTTAGATTTTCTTAGTAGCTCCAGATTGTATATCTAGTGTCTCTGTCTTAATTACTTTAAAACTTATTTTCTAAA ATAATATTTCCTCTTTTATTTCCGCTTGGTTTCGTTTCCTTATACTTATTTCTGGGTTCTGTTTTTGTTCACACCCCTTG ACAGATTCTCTCATGCCTTTGCTCTGTCTACTCTTTCTTCCTTATACGTACAGTTGTTGTGTTCATTCCTTCTTTTATGT TCTTCTTGTTTCATTCCTTTCTTTTCTGTTGACTTGGTAGCTCTTGGGCATATTTGCATATCTTACACAAGCCATTGGTT TTTTATCACATACGCATCAGAATTTGTATGGCAAATATGATATCTGAGTAATTTTTAGGCCTTTATGTAGTTACCGCTAA TTTATAGCCAGGTAGCCATAAAATGGATATAACAATATAATTCAGTTAATTTGTCATACAATACTGACAATACTTAATAT CTGAGCCACAATTACTATATAAAAATATTATAACATTTAGAATTTCTTAATTTTTTTTAATTTGGTCCTGTTAATTATTT ATTGATCTATTATGCGATTTATATATATATATATATATATTATGATTAGATATTATGACAGAACATATTTAACCCTTTGT TCGTAGATGACACATGATGCTGAGCAAAAAGAAATACAAATATGAATTTATGTGTTTATATATAATTTCCTTCGACGTTT AATATATATAGTACTTTTATTTTATTTATTTATTTTGTATATTATATTTAGTCTCATTAATATTGTTGAATCACATTATT GTACATACAAGATTATTATATATGTGTTGATATTAATTTATTTACAATAAATTACAACTCTGAATAGACAACCCCATCTT TCATTAATTACAAAATCATATGAATTATTTATTGCCATTCGAACATATTGTCATTGTATAATGCAATAGTTAAACAACTC AATTGTTTACTTTCTTTCACATTTCTTTCAGTTACTTTAGATTATTTTTAACCCACATCTACTTATCGTCAGAATTTTTA GTCATCTTGCTGATTACTTATATATTTACGAATCCATATTAATATAGTTTTCTAAAATAAAAAATTAGTCAGACATTCAT TAAATGTAGTCTTTATAATTTACCAAGAAATTCCATTATTACAATAAAACCTAATTAAATAATATAGCAATAAATCTATA GGATATGATTTCAAATAAAACTTAAGTTGGATTTAATAAACTTCTAATACTTTTAATATAAAATAAAATATCACATTATA GGCTTATTTTATTAACTTAAGAGTGACATTTTTTCTTTTTTTTTTAATTACTTAGATAATGTTATACTATGGTTAAGAGA TGAATAAGACAGGAATTAAAAAGAAACGATCATGATCAAATCAACATGCGCATTGTGTAATCTCAGGAATGGATCTAGAT TTTAATATCAATATTGATGAATGTTCGGATCAAATTAATCAAAGTGTTGATTCTAGATCAACAACAACATCTTGATCCAG ATTTGATACAATGATGACATCCTTACAACACTCCGAGAATGCTGCATCTCATTCGCCAATATCGCAAAATCGTAATGGAA AACGTAATTCCCTTATCTACAATATCTATTAGGCTTAGGTAATTATAATTCCCTCATAATATTAATTTCTTACATATTTT TTCTATCATTGTTCTTAATTCCTTTTCATAGGTGTCAACAATGCATACATCGATCTTGGAGACTGTTGTTGCACCTGTTA ATATTATGGTGCACTTTTTTGGTTCAATGAATGGATCAAAAATAATAACCCTCCTAAATTTAACTTATGTTGTAAAAATA GAAAAATTACTCTGCCCTTCATGAAAAAAAAAAAAAAACACCTCCTATACTAGACCAATTACTAAATTATTATGGGGGGC CAGGAAGTACACATTTTCATAAATATATTCAAATATATAACTCTATGTTTGCATTTACATCCTTGGGTGCTAATATAGAA ACAAATACAAGAACTCCTGATGGTCCCTATATTTTCAAAATAATGGACAAATACATCATCTCATTAGATCTCTCTTACCA GTTAATAGCAATCTTCTAAGATTAGCACAATTATATATATGACACAGAAAATGAAGTTTAAAACTGAGTAACTTCACCTT CATTCAATGATCAATCAAGCGACTTAGTTAAGTTAATAACTGAAAATTTGATTAAGATGCTTGATAGTACAAATAAATTA GTTAAACTTTTTCGAACGATAAGAGATAGATATAAAGAGGATCAGATACAGTCTATGAAATTAAGACTTATAGGCAGAAG ATACACAAATAGTAATCAATATGAATTACCTACTTCAAATGACATAGGTGCATTAATAGTCAGAGATATTGGTGATATGA AGAAGGGAGAGACATTATAATCCAGGATTGAGAAAATACCTTACAAAGAATTACAAAATTACATCCATGTTACATGGCTC TTCAATACCCTTTATTATTTCCATATAGAGAAGATGGTTATAAAACAGATTTAAAATATAATACAAACAACCCAAATAAC AAATCCAAAAGGAAGAGAATTTCTATGAGAGAATTTTATTGCTATAAGCTACAAGAACACCAAATACAAGGCACTACTCT TTTTCGAAGCGGCAGATTATTTTAACATTACGTAGTCGATGCATATGCTTCTATAGAAGGAGATCGCTTAGATTATATAA AAAAAATCAAGAAAAATCTAAGATCTAACATTTATCAACGGATTCAAGATGCTATTACTAGAGGAAATATAGATGCACAA GCGATAGGAAAAAGAGTAATCCTTCCTTCTAGCCATGCAGGAAGTTCAAGATATATGATCCAAAATTATCAAGATGCTAT GGCAATTTGCAGACAATGTGGAAATCCAAATTTATTTATAACATTCACATGTAATCCAAAATGGCCTGAAATTACTAGAG CATTAGCAAAAATCCTAGGACAAAAACCTGAAGATAGACTAGACATCATTACAAGAATTTTTAAAATGAAAGTAGATCAC ATTTTATCCATTATCAAAAATAAAAAAACATTTGGGACGGTTATAACAGGTCAGTCTATCTTCTCCAAACCCTTCTTTTT TCCCTATTACTTCTTTTGCTAAAAAAAATTGAAAAAAGAAAATTTCTTCTTAATTTTGTAGACTTATATGTCGTGGAGTT TCAAAAATGAGGCCTACCGCATCGTCATTTTCTGTTTTGGCTCCACGAAGATGAAAAATTGCATGAACCATCAGCAATAG ACAAATACATTTCAGCAGAAATACCTCATCCTAACAATAACCCATTAGAATATAATGTCGTCGCTGAATTCATGATACAT GGGCCATGTGGTATAATTAAACCCAGCTCCCCATGAATGAAAAATTCAGAATGCTCAAAAAGGTTTCCAAAACAATTACG AAATGAAACAATAATTGAAGAAATTGGATTCATTAATTACAAACGAAGAAATATAATTTTTTATGTTGAAAAAGAAAACA TTAAATTAGACAACAGATTTGTTGTTCCTTATAATACGGAATTATGCTTGAAATTTCATGCTCATATCAATGTTGAAATT TATTCACAATCTATACTCATAAAATATTTATTTAAATATTTGACAAAAGGACCAGACAAAATAAGAGCAATCATAGAAAA TAATATGAATACAAACAATAACAAACAATATTACCTATCACGAAGTAGACGAAATAAACAATTATATAAATTGTAGATAC CTAACGCCATATGAAGCAATGTGGCGACTATATGAATTTCCAATACATCACATAAATCCAGCTGTTCAAAGATTATCTAT ACATTTGCCAAGAATGTAAAACATAATTATTCATTCTAATCAACGCCTAAATAATATAATGTGACAACCATATATATACA GAACAACTCTTACTGAATGGATGGAAACAAACAAACACGATATTAATGCCAGAAAGCTAACCTACATAGAATTTCTAACT AAATATGTTTAGAATAGCAAATATTAATATTGGTTTCCAAGACAAACAGGATATACAATTGGACGAACTTTTCATGTCTA TCCCAGCTCTGGAGAATTATACTATCTAATACTATTACTGAATCACCAAAATGGAGCAACAAGTTATGAGGCTCTTAGAA CAGTCAACAATGTAACATATCCAACAAGACAAGCAACATGCTATGCACTTGGTTTATTAGGAGATGACAAGGAATGGAGC GAATCAATAATAGAAGCCTCATTTTGGTCAACATCAACCCAATTACGATAATTATTTATCATGCTTCTATTATTTTGCAA TGTAACAAATCCGACAAAGTTACTCAAAAAACATTGGAAGCTTATGACGGACGATATTTTACACAAACTCAGATCCTTAT TTAACAATCCACATTTTCAAATACCTGAAGCCGAATTATATAACTTTGTATTATATGAATTTGAAAAATTTCTTAAATCT CAACTCATCAATTTTAACACATTTTAGTATACCTCTTCCTACTGGATCATTAATGGATGACCTAAATAATAAACTCTTAA GAGAAGAACTTAATTACAACACAGATAAATTAAAAATAGAAAATTTAAAATTGCTACATAATTTAAATCATGAACAATGA TATATTTACGAACAAATTTTAGAATCATTATATCGTGGAAAAAATAACATTTTTTTATCTGTGGTCACGGCGGAACTAGC AAAACGTACTTATGGAATGCATTAATTACAAGAATTAGATCAAATAATGAGATAGTTCTTACCATTGCATCATCCGGGAT AACATCAGTATTATTGCCTAAAGGAAGAACAACACATTCTAGATTTAAAATACCACTATCCATAGATAAATTTTCTACCT GTCACATTAAAAAGGAACTCAATTAGAAAAATTAATAGAAAAAACATCACTTATATTATGGGATGAAGCACCAATGACAA ATAAATATTCTTTTGAAGCATTAGACAAGACACTTCAAAATTTAAGAAATAACTATCATCATCCATTTGGTGGAATAACA GTTGTCCTAGGAGGTGATTTTTGATAAATTTTACCAGTTATTCCCATAGGAACAAAAGAGGACATAATAAATGTAACTAT AAATAATTCTTATCTATGGCCACATTTTTGAATTCTAACATTGACGAAAAATATGAGATTAAAACATCACAATGACACAA GTGAAGAAGTAAAAGAACTTATAGCCATTTCAAACTAGATATTAAGCGTTGGAGATGGTACCGATGAAGGAATAAAAGAT ATAGAAAATGAAGATGTTACATGGATAAAAATACTAGAAAAATATATATTACATTATCAATCAAATCCAATTGAAAAAAT TTCAACATCAATCTATGACAATTTCAATAACAATTTTAGTAACATTGAATATTTAAAACAACGAGCAATAGTAACCCCAA AAAATAAAATAGCAGACGATATCAATAATTATCTACTATCTTTGGTCCCAACAGAATTAAAATCTTATTATAGTTATGAT ACAATTGTATCTTCATCTGGAAACATAGATGAACTTAATTTCTGATATCGTGAAGAATTTCTACACAGCCTTGAATTTAA TAGAATACCACCATATTAACTAAACCTTAAACTCGAAACTCCTATAATATTATTAAGAAATCTAAATCAATCCATCAGAT TGTGTAATGAAACAAGACTTATCATTACACAATTAACAAGTAAAATTATGGAAGGACAAATTATAAACTCAAATGATATT ACTTAAACAGTCTATATACCAAGAATATAAATGATCATACATGAATCTAAATGGCCATTTACATTAAAAAGAAGCAATTT CCCGTCAAAACTTGTTATGCAATGACAATAAATAAAAGCCAAGGAAAATCATTGAATAAAATTAGATTATATCTAGAAAG GGAAATTTTTACACATGGACAATTATATGTAGCTTTATCACGAGAGACAAACCCAAAAGGATTGCATATACTAATTCACG AATCAATTAATAAATATCCAAATCATGTAAAAAAACATTATCTATAAAGAAATTCTACACAATATCAAATAAGACATACA TATTATAGTTTCTTTTATATAGCAAAAGTATTTTATCATCAATAAAATTAAAACATATCCATCATCGTAATGCACCATTT ATTATATAATTAAAATCTTTTATTATAAACATACTAAAAACATATCCAATAAAATTATTCCTTTACTTATTAAACAATTA TTTCTTTTCTTTAACAGTTAAACAAAATGACAACACCAATCCATGCACTGAAACCAAATGAAATTTATGAAAGAATTAGG GCAAGAATTTTCAGATTATGGACAAACAATGATCTGACGACAGGACGTTTAATCAGCCTCGATTGTCTCTTAGTCGATGA AGAGGTAACAATTCTCGCAAATATTACATTATATTATTTTTGATCTAACATTAAATACTATAAAATAAATAACATTTTTA TTTTTGTCACTCGCAGCATGAAGCAATCCAGGGATCAATTCAGGCACGTGACTCAGACACTATTTCTGAAAAAAATCCAA TTGGACAATATATATGACATCAGCAACTTTTTTGTTTGTGAGAACAAACCAACATACAAAGTTGTACCACACAATGTAAT GCTATAATTCGCACGTGCAATATCTTTTACCCCAGTTACAGACGAACCATTGCCCATTCCATTTCATAGGTTTTACTTCG TTGAATTCGACCAACTCCAACACATAATCGAAACAACAGAATTCTTAAGTGGTAATGTCAATCACTCTTTATGATTAAAG AAACATTTATTAATTTAACAATATATTCTTAACATTTTTTATTCATTTGCATACAGATGTGATAGCTATCTAGCAGGAGT GCAAATACTCGAGCAAGCAAGTGTTGCCAGAAGTTCAACAACGCGGCGCACCATAATGATCCAAAATATAAGGTAAATAA GTTCTACAAAAATTCTATTTTGACCATATGGAGAAAACATATAATTACAAAAAACCAAAATTTTTTGCAATACTTAACAG ATTTTTACATCAATCTTTTTCTTTTATTTTGTCTTTCCAACAGGAATGAACAACTCCAAGTTACATTATGGGGATACAAA GCCGATCAATTTGATGAAAATGTTATAAAATTGATGCAAGGACCAGTTGTAGCAGTTTTTACATCAATGTTGGTTAAGCA ATATTTAGGTATTTTCTCAGCAATTCAAAACAATATTTTTATATAGACATAAAATACTTAGATATATGTATAACAAAGCA CTAATCAACTTATTATAAATTTTTCAGGCAATGCATATGTCTCAAGTACAACGGCAACAACTTTCTACATTGATCCAGAT ATACCAAAAATAAAAACACTAAAAACAAGGTAACTAAAATAATCAACAAAGTCTGAAAACAAAAAATTCTTTTACTACTT CTTTATTTAATTTCTTTTAACTTTACATGTACAGATTTGCCCACCAAAATCAACAAATTGAATTCCCAATCGCATCAGCA ACACAAGCACCATCCATCGAAGAACAAAGGATAGCAAATAGAAAAACAATCAATGAATTAAAATTGCTACAACAAGAAAT TAATCAAGTCAGTACTATACGGTTTCACATTCTTTTTACTTTAAAACTACACTATTTAGGATGACAATTTATTCTTAATT ATAAAGGACCTAAAATTTACGGTGAAAGCTACAATAATTGAATTCTTAGGAAGCCAATGATGGTACTGTAATTCATGTCC TAAATGTTATCAACAATTAAGAGAAGTAGGAAGCGGTTGGTGGTGTAATAGTCACGGGCATATAAAAACAACGCCATCCC CATGGTAATCAAAATTAAAAATTATTTATTATAAAAATCTATGTACCTTCCTTAATTATTATAAATAATGTTTCATACAT ACAATCTATTACTATATAAAATATAGGTACAAATTAATCACAAAAATCGAGGACCGTACCAGAAATATGGATGTAACTAT ATTTGGCAGAGCAGCACAGGCCCTCATCAAGAAACCATGCTTCACTCTAACAATAGATGAAGGCTTTACAGATCGGTTCA CAATCCCACCAATTATCAACCAATTGAGAGGGCAAATAAAAATCTTCCAAATATACTTCCAACAAATAGGAGGATAGATA AATACAATCGCACTGAAGATATTTGAAGACACTCAACCTGTAATATCATCACCACAAACATCTCCCACAGAAATACCAAC AACAAGGTAAAATATTTTTACTAATTTATATCAATTGTATATAGAAGACAATATCTACTATTTCAAATATATATTTAAAT AATATTCTATTGTTTCAGCCCTAAAGCAGAAACACAACCATTAGTGCTACCACCAATTGAACCACAGACACCAATCCCAA AAGAATCAGCTATAAGGTAAAATATATCGACTTATTTATTTTACTCATCAATAAAAAAATAATAACTGCAATTTTACACA TATATATGTTAATAACATTTTCCTATTTTCAATTCTCACTCAAAAGAAACACAGCAGCTAAGAAAACGTCCAAGAACCAG GTAACACAACCATACTTAAATTGAAATATTTTTAATCTTCAAAATTATCAATGCTAATTTCTCAAAAATTTATGTTTTGC AGCTAAGAAAGAGCCAGGGAAATAAAAAGAAGAAATCAAACTATATATATACATATACCTGTAAACTCAAACACATTGTA TATATGTACATATACATTGTAAATAACTTTTTATAACAACATCATTGTAAATAACATTGTAAATAACTTTTCATATATAG ACATATATATATATATATATATAAATACATTACCATAAAAATTGTCGATTCTTTCTATATCACAACATTATCACCTGCTA CAACGCGCGGGCATAAGGCTAG