>DHH_16_1_Mno length=11671;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATATTATATATATTTCTCTATATATTTTTAAATAAAATATGTAACTTTTTTTTCCAATCATATTATTATTATTATTT TATACATATACTAAAGGAGATGACAGGATTAATTGTTCATGCTACAGTGCAATGAACAGTATCTTTCCCGTTTTACCCTT ACTTTTTTCTGCTGATGAATTTTTTATTCCCGTTATGTCCTTTTGAGTGTAAACTTACTATATTATCCTTTCATTCAGCT TTTTTTGTTTTTGTTTGTTCTGACCGTTTTGGTCATTTACACTCAGAATGACTGTTTTATTTTGCCTTTTTTCGTTTGTT GCTTTTTGAATTGTTTTTCTTCCCTTCTTTCTACAGTCATTTATCACTTTCAGTTGTTTTCTTCTGCAACCTTCTAGACC TCTTTTTTTTCACTCAAATTGAGTTTTTTTTTTTTTTTTCGTTTGTTGGTTTCTATGATTTTACCTTCTTCATATGTGTT TTTATTTCTTTGTTTCTGCAGCAACATTTCTTTCTTCCGTTTGTTTTCTTCTGCAACCTTCTAGATTTGTTTTTCTTTTT GCGCACTTAGATTGAGTGGTTTTTTTTTTCTTTTTCATTCGTTGGTTTCTATGATCTTCTAGATCTGTGTTTCTTTTTCT TCGTTTCCGGATCTACTTTTCTCCCTTCTATTTGTTTCCTTCTGCAACCTTCTAGATCTCTTCATTTTTTCTATTTTTGG GCCAGATTTCTTTGTTTCTCATCTTTCTTCTTTATGCAACCTTCTAGGTCTTTTTTTTTTTTCATTTCTGGACCAGATTT ATTCATTTTTCATCTTCTTTCTTTTTGCATATATATTTTTGGATGTTTTATGTTTTATTTTTTTATTTTTCTTTGGTTGT ATATGCATGGTCCTTTTCTCTTTCCTTGCGCCATTTGTTATCTTCGTCTTTAGTTTGGTTGATTATTTTTGTATGGATTT CATGGATTTGGTCATTTGTTTCAGATCTATGTTCTTATCCACTTTTTTTTGGCTGTTTGGTCGTTTAATTCATATCTATG TTTTTACACCTTATTATATTCCTCTGTTTGTTTTAGCTTTGTTGATTTTCTGACTGTCGATTTTTCTTTAATTTTTACAG TCGTTTTTCCCAGTTTTCTTTTTATGATTTTTGTGGGTATTTTGGGTTTTGTTGTTTTGTTTATGTTTTTTTAATTTATT TGTTATTCGGCTATTATATTTGTGAAAAATTTTTTACTTTGTTTTTTTCATAATTTTAAATTTGTTTACCCATGTTATTT ATTTTTTTGTTCCTTTTTTTTTACTATATTTTGATTTCTTCGTATTTTTTTAAATATCATATCTGAATTTGAACAAATCT CTAATATTTGTCGTGATCTAAATGTAATAATATTTATGTTAATCTTTTACTCTGACAAGTGTATTTTTTATCTTTTCGTT TTGTATAATATGTATCCAAAATATAACTGTTTGTTGGTCTTCATGTAATGTGACGGCGGTTGTTAATTAATCATTACTTC TATTGCTTTCTGTTTGCAAGGATTTGTACCCGAGACTAAGCAAAACATTGGTAAATTTTTGTATATATATCGTATGTTAA TTTTTTACTCTTTCTTTGTCTTCGTCTTTCAGCTAATATTATCTATCATGTTCTATTCTCTATGCTTTCTCACTGTTTAA AGACCTTAATGATACTAGCCATTTCTTACTAACCTTACCGCCTCCTTTATATTCCTTTGCTCTATTATTGCTGCTCAGTA ATTTTGGTTGCTTTCTTTGATCTATCTTATTGCCCGTGGTTCGTTGAATCATGTATTCATTTTTTTAATTTACTTTGGTT GATTTGTTTTAGAATATTAATTTATAATGTTATGTTTGTTCGTTATATGAAATATTTTATCCTGTACTTTACTTTTTTTC TTCTCTACCATACTCTCAGTCATTTACTACTATTCTAATTTGATTAACTGAGATTTTATATTCACAAAATTTTCTAAATC TTATTAAAATATAATGTCTTTCTTTATAAAAAATTTGGTTTTTTATATCCAAATATTTTATTCTCTTCTGGTTATGATGA TGTTATATTTCATTTGTTGTTAATATGTGTCAGGTAATTGTTATTACAGATATGGCTATCATTGATGTTGCCCTTATTAT TTTGGACTTATGCCAATATATTTTAATTTGTCTTTTATTTTAGTTTTACTATATATTTGTATTTATAAAAACTGCTTTTG TCTATGATACTATTTTGTACATTCCCGTTTGTTTCCTCTGCAGTTTACTCTTTTTCTTCTTCACTGTATTTTTGGTCATT TACTGTTATTCTTAATTTATTAACTGACATTTGATATTTACACAGTGTTCTAAATCTTATTACAATATAATGCCTTCCTT TATCAAAAACTCAGATTCTTGTATCCAAACATTTTATTCTTCTCCGGTTATGATGATGTTATATATAATTTGTTGTTAAC ATGTGCCGAGTAATTGTTATTACAGATATGGTTATCATTGATGTTACCCTTATTATTTTAGAGTTATGCCAATATATTTT ATTTTGTCTTTCGTTTTACTTTTACTATAACTTTAAATGTTATGGTTTTAACTTATTTCTTTTTACTTTTTTTAGTGAAC ACTGAAATCTTTCCTTTTCCTTACTATGTGTATAATATTGTATATTGTTATTTTAAGCTATACTAATTTTTCTTACTAAT GGCATAAACTCTTTAATAATGTAGCTGGTAGCCATATATATTGCCAGATTTTGTTTCAATTACTTATGGTATATATTCTT CACAACAAATGAATATAACCTGAACCAAATGTATACTAAATTTTCTTACTTATGGCATAAACTCCTTAATAATATAGATG ACAGCTGTGTATATTGCTAAATTTGTATCCAATTACTTAAGGTATATGTTCTTAACAATAAATGATTATAACCTGAACCA AATATTTATATATAATCTTATGTTTTCCTAAATGTTTCTTCATATATTTATAATCTCTACTCAATTTACAGTATAATATA AAGCATTTTTTTTCTGTACACTGATTTAATTTATGTATATGATATATTAGTGTAACTAGGTATATTCCACAAACTGTTTG ATTCTTATTCTTTTTTATATTGCTCTATCATTTATTCCTCTGTTTTTTCTTCTACGGTTCTGTATATGATTTTATTTTAT ACTTTTCTGTTTGTTTTCCCTGCGTTTCCCTCTTTTTTCCATCCAGTCCACTCTCGGCTAAAGTTATGGTTTTAACTTAT ATCTTTATGATTTTTTTAGTGAACACTGAAATCTTTCTTTTTCCTTAGTATATGTATAATATTGTATATTGCTATTGTAA GCTATACTATTTTTTCTTATTTATGGCATAAACTCCTTAATAATGTAGCTGGTAGCCATGTATATTGCCAGATTTCGATT CAATTACTTATGGTATACATTCTTCACAACAAATGAATAACCTGAACCAAATATATACTAAATTTTCTTATTTATGGCAT AAACTCTTTAATAATATAGATGGCAGCCGTGCCTGAACCAAATATATACTAAATTTTCTTACTTATGGCATAAACTCCTT AATAATATAGATGGCAGCCGTGGATATTGCTAGATTTGTATCCAATTACTTAAGGTTCTTCTCGGGTTCTGTATATGATT TTATTTTGTACTTTTCTGTTTGTTTTTCCTGTGTTTTACTCTTTTTTCCATCCAATCCACTCCCGGCTATTCACTCATAT TCTTATTTGATTGACTAACATTTGCTATTTATACATTGTTCTAAGTCTTACTACAATTTAATGTCTTTCTTTATAAAAAA TTTAGTTCATTTTTATTTTTAATAATATAGATGGCAGCCGTGGATATTGCTAGATTTGTATCCAATTACTTAAGGTTCTT CTCGGGTTCTGTATATGATTTTATTTTGTACTTTTCTGTTTGTTTTTCCTGTGTTTTACTCTTTTTTCCATCCAATCCAC TCCCGGCTATTCACTCATATTCTTATTTGATTGACTAACATTTGCTATTTATACATTGTTCTAAGTCTTACTACAATTTA ATGTCTTTCTTTATAAAAAATTTAGTTCATTTTTATTTTTCTTAACACTTATATTTACAACCAATTTTCTCATTTTTATA TTTGCAGCTAAAAGAAATGAAATGCTCAAGAATCACAACATCGTTGTATTTTATTTTGTACAATCTGTATATATATATAT ATATTCTAAATAATAATACTATATATATCTGTATAAATATATTTGTATAAATTTTATATCTATCATATAATACAATACTG TATAATACATGTATATATAAAAATATATTTTAAATACAACTATCATATAATACAATAATATACTCTGCAGCAACGCGCAG AATACTGGCTTGTATATACTAAAAGAGAGGAAGGAAATCAATGTTCCTTGTAATGAACAGTGACATTCCCGAATTGCCCT TGCTTATTAAGGGCTTGTTCTTTTGGAGTTTAACTTGAGTATAATTCTTAAGTTGAATTTGAGTTATAACTTGAGTTGAA CTTATAACTTGAGTTTGTGTTTGGTTGAGTACATTTGAGTTATGGTTTGAGATAAGAATATTTTTGAGTTTGTATTTGAG TGAGTCAAAACTTGAATTTGTATTTAGATAGTATTTTAATAAAAACTCAATGCTGATCAAAAATTTTAATTGGGTATATG GGTCGGGTTTTATTCGTCTTTTCGTTGTCAATATATAGAAAAAAATCATCTCAATCGGAATTAAAACGAAAAAGTTATAG CATTTTTAAGAATAGATAAAATACTGTTCATTAAATTGAGTTCAAGTTAAAAGAAAAACTTGAACTTGAATTTTAGTCAT AAACTTGAGTTTAAACTTAAAAAAATATAAACTCGATTAAAATTGTAACTCGAGTTACATTTTTTTTTTGAGTTTTTCGC TCAAAACAACGAGCCTTAATTTCTTCCTTTTGGTGCGATTAGTTTTGCGGTCTTTTCCGCGCAAATGAGGCTTTCTGCCT TGTGCTCTTCTCGATGGTTCCATCCTTTGTGCCTCTTTTGTTTCGTTCTCTTACATATCCTCGATTCTTTCCTTCTCTTC TTCGATTTGATTTGGGTGGAAATTGGGGCTTCTATTTGTTCTTCGTTTTCGGTTGTTCAGTAGTTCGTTCTTTGGTTTTG TTTGGGAGTTTGCTGTGGCGATTTTTTTTGAAACCCTTAGCCCTGTTTTTCGGTGTTTCGATTTGCTCCGGTTGTTTTAT TTGATTTTCATCAATATTAGGGGCTTTTGTTTGTTCTTTCTTCTCCATTACTCGGTTGTTGGTTGTTGATTTTGTTCGGG AGGTTTCTACGATTTTGATGGAAATTTTTTCTGTTGAATCTGGTTTTCATGCAGGCTTTTTGCATTCTTCTTCGCTGCTT CTTTATTGGGCTGATTCGCGATCCTGGTTTGGTTTCCTTCACCCCATTGCTGAAATGCATGTTTTATGGCTCTTTTCATT GTTTGCTTATAGTATTTTTTTCCTCAGTTTTTAATAACTATGTTTTTTGGTCACCGTTTGGATTAAATTTCTTGGCATTT TTATTAGCTTTTTTCTCCGATGTTTGCTGTCTTTACCATTTGCTGAGAAAATATAGATACTTTGCTCCTTTCTATAGATT GCTCTGGATATCTTCTTTTGCATTTATTAATTTGCTGATCTGTACTATTTAACATGCTGATTTGTCTGCTTAACTTGATG ATCTGTGCTGATTTTCTTGCAGAGCTATTAAATGGATTGATAATTTTTTACTTTATTGTCTGAGATAGGTGAAATACGTG GGAAGAAAAAAATTTGTTTTTTCAGTTTTTTCCTGCTTTTATCCGCCTTTTTCTTCTTCTGAAGTGATTACCATTTAATC TTTATTTCCTTCTTCTATTTTCTTTACGGGACCATTTAATCTTTATTTCCTTCTATTTTCTTTACCGGATTAATACAACA CTCTTATCATTTGATTAATGAATATTAATTTGTATCCTCTGGAAACTGGTCCTCTGTTCTTACGTGTGAGGCTTTTATAG GGTATGTACTTTTGCTAATTGTTTTTCTTCTCTTCATTTATAAAAACTGATCTTGCCTATGAGTATATTCTGCACTTTCC TGCTTGTTTTCCCTGCACTTTACTCTTTCTCTTCTGCATCTTACCCCCGCTTATTTACTACTCTACTTCATTATCCATCC TTTACTGTTTTATCCTGCTATTTCTATATCCTTTCTTCACATTTAGTTGGCTGACACTTCATACTCGAAGAAGTATTTAT AGTGTTCCTGGTATTATTAATGATTCTTGCCCATAACTCTTTAATATGTGTTCCTGATGTTCAATATATTTATTTGCTGT GATTGTATTAATCCATATGTTGTTTTACTTTTATAATTTCTGTTTGCAGCTGATTTTATTATATTATTAGTTGATGTTAG TACTATGTTTTGATTTATTTACAAAAACTGATGTTACACATGGATTTATTCTGTATATCTTTCTTTCTTTTGCTTCCACT TTATTGCCTTCTATATTTCAGCTTTAATTATTTAATGTCCTACTTTATTATGATCGATTTATTGCTTTGTTTTGATATTT TGGTATCGTTTCTTTTGTTTTATTTGTATTTAGTTGGTTCGGATATCACATTGAAAGGAATATTTATAGCGTTTCAGGTA TAATAACTGTTATCCAGAATTGCTTAATATCTACTCCTGATATTTAATATATTGCCTCCCTTTAGCGATATTGATATGTG ATGTCTCTGTTTTATAACTTTTGTTCATAAATTTTTTCCCCTTTTCCCTCTTTCTTTCCTCTCTTTCATTAGTAAATTTT AGTCACATTGACTACTACTTTGACTTTCTCTTAGATGACATCTATATACATATCTTCATTTCATATATGTTGTTTCTAAC TGCTTTGTTAATAGAAGAACAGTGACTATAGTCAATTTTAGGCTTGTTTCTAAATATGTTTTCCTTGGTTGGATTCTTCT TTTGTCCAACTTTCTTACTAAAAATAATTAACCACAATCTTTTGTTCATTTGTTGGCTATTCTGATCTTCTTTCTTTCAT CATATACCTATTTCATTCAAAACTTATCTACATAAATATTACTTCCCTGTTTTTCCTGTGGCGATGATGATTATAATTGA TTTTGACATGTTGAGTGTTATATGATTTGTCCAAAAATTACTGTGAATATATCCTTCTCATTTGAATTTTATTTTTCTTT ATTCATTTTTACTACAATCTTTTATCTCTCCTTATTCTTTTTTTAATTTATTATGGTTCTTTTGGCCTTTTGGTATCACT AGTTTATTGAAAGCTTCTTTACACATAAATCAGTTTTCTTTTCTAGCTCTCAGTCTTTCAACGTTTATTATTCTATTCAA TACTCATTCATTTATACACTATCTTTTTATTTGTGTTACTCAATTTTTCTTCCACTACCATTTTCACTTGATATTTCTCA TTGTTGCACTTTTTCTCTCTGTTTTAAAGCCTTAGTTTCAATTACCCTCTCCCTTTGTCCCTTATTTTACAAAAAACTTT TTGATGTTTTTCCTACTCTATGATTTTGCTGCAGATTTCTGTCCGCTATATTTCATGAAAGGAATATTTATAGCGTTTCA GGTATAATAACTGTTATCCAGAATTGCTTAATATCTACTCCTGATATTTAATATATTGCCTCCTTTTAGCGATATTGATA TGTGATGTCTCTGTTTTATAACTTTTGTTCATAAATTTTTTCCCCTTTTCCCTCTTTCTTTCCTCTGTCTTTCATTAGTA AATTTTAGTCACATTGACTACTACTTTAACTTTCTCTTAGATGACATCTATATACATATCTTCATTTCATATATGTTGTT TCTAACTGCTTTGTTAATAGAAGAACAGTGACTATAGTCAATTTTAGGCTTGTTTCTAAATATGTTTTCCTTGGTTGGAT TCTTCTTTTGTCCAACTTTCTTACTAAAAATAATTAACCACAATCTTTTGTTCATTTGTTGGCTATTCTGATCTTCTTTC TTTCATCGGATACCTATTTCATTCAAAACTTATCTACATAAATATTACTTCCCTATTTCTATTACTAGATTTAGTCTTTT TTTCCCCTTTCTTTTTCGGTTGACATCTTTTGCTCCCAATCTGTTTTTCCTGTGGCGATGATGATTATAATTGATTTTGA CATGTTGAGTGTTATATGATTTGTCCAAAAATTACTGTGAATATATCCTTCTCATTTGAATTTTATTTTTCTTTATTCAT TTTTACTAAAATCTTTTATCTCTCCTTATTCTTTTTTTAATTTATTATGGTTCTTTTGGCCTTTTGGTATCACTATTTTA TTGAAAGCTTCTTTACACATAAATCAGTTTTCTTTTCTAGCTCTCAATCTTTCAACGTTTATTATTCTATTCAATACTCA TTCATTTATACACTATCTTTTTATTTGTGTTACTCAATTTTTCTTCCACTGCCATTTTCACTTGATATTTCTCATTGTTG CACTTTTTCTCTCTGTTTTAAAGCCTTAGTTTCAATTACCTCTTAGTTTTCCCTCTCCCTTTGTCCCTTATTTTACAAAA AACTTTTTGATGTTTTTCCTACTCTATGATTTTGCTGCAGATTTCTGTCCTATATATTTCATTGCTTCCATTACTGTCAG TTTAGGCTTTTTTGGTCATTTTGATCAAAATGAAATGTCACCATTCATTGATTACTTGATATTTCTCATGATTGCATCTC TTCTCTCTGTTTTAAGGCCTCATTTTGAATTATCCTGCTTCTTTTTTCCCTCCTCCTGTCCCTGATTTTACAAAATAGTT TTGCATCTTTTTCTTGCTTTATGCTTTTGCTCCAGGTTTCTGTCCTCCATATTTCATTGCTTCCATTGCTATGAGTTTAA CCTTTTTTGGCCATTTTGATCCGGATGAAATTTCCAGCTTCATTGCTTACTTAATGCCTTCATTTTGGCTCATTTTGTTT GCATGTCCTTTTCACTTCATATTTCTTATTATCACACTTTTTCTCTCTGTTTTAAAGCTTCACTTTGAATTATTCTGGTT TTCTCTTTTTTTCCGCTCCCGTGCTATTTTTTCCCCTATATCTTTGTCCCTTATTTTACAAAAAGTTTTGGATCTTTTTG GTGCTTTATAATTTTTTTTGAAGCTTTCTGTCCTTCCTATATTACTACTTTTATTATTGTGGGTTTAAGCTTTTTTGGTC ATTTTACTCCAACTGAAATCTCAGGATTCATTGGTTAGTAAATGCTTTTACTCTTGCTCTCTCGTCTGCCATATTTGATT CAAAATCTTAAGCTCATGCTTTGTTTAATATTCTTATTGTTTTTTTACTCTTTTAATTCACATGGTAGTTCCTGGACAAC TCTATCTTTTACTTCAATCATTTATTTTGTAACGCATATTTCTCATAATTTGTCTGGTATATATAACATCTGACTAATTT TTTGTACTTTTATGTAGCTGCTGCCAATAAGCAGCCATAAAATGGCTATAAAAAACATAAGTCAGTTAATTTGCTGCAAA TTGATGACAACATTTGATATCTGAGCCACAATCACTATACATAAGTATCATTATATTTATAATATTTCAACTCTTTTAGC TTAATCTTTTTTATTTTTTAATATATTTATTTATATTTATTTATCACTTTATTCTTGATTCGTTTTTTTAATCAAATTCA TTAAGGCAAATCTTACCATGCAAAGTTTTCAGTCTATTTGTTTGTGTATCATGGAAGCAGCAAAGAATGGACAAATACAA GATCAATCCATTTATTTTATATTGTTTGCTTATGAATTTAATTCATATATTATTCTTATGTTATTTATTTCGTTTTGTAC ATAATAATATTTAACATTATAAACTATATATTTTTATTATTGTAAATATATCATCATTGTGATTGCTTTTGTATTACTTT ATTCAAGATCAATTGCAATTATGGATATATAATTTCCTTAATTTTTTATTACAACATTATCTATGTATCAATTTATTACG AATTTTAATGCGTTATAAAAGTGTACTACAATTAGAATAGATTTTTGCATATATACAATTGATTAAATTTGCTACTTGAT TATGTTTCTTTTATTTTTTGCTTCTTCCAGATGAAAAAAAAAATGAAATACCTATGCATATGTTAGATTTTATTACTTTC TTCTATATTTGCTTTTTTCATTTCCTATAGTTTTAGTCATCATCTATAGATTTATCAATCTATATTTATATAAGCCTTTT AAAACAACAATTAATTAAATATATATGAAATGTACTTTGCATAATTTATAAAATAATAGCACAATTGAAATAACAACTAA TCAAGTTAAAAAAAACGTTGATGAAAAAAATAAGCTTAAAAAAATTACAAATAAACAATTTGAATAACTAATTTTTAAAT TAGGTTTTGATCTTCTTCAAACTTAAATAAAAATTTAACCCATAAACCTATATTATTGACCCCAAAATAATATATTCTTC TTTCTTTTAATCCATAAAATGATCTCATATTATGATCAACAAACGGATAAAACAAAAGTTAAAACGACCACAATCGAATG AGCGTATGCCTCTTGTCATTTTAGAAATGGACCAACGTTTTAACAAGACGATTAGTCAATATTCACATTATATCAATCAA AATAACGACCCTGTATCAACAACTTATCGGTCCAAATTTGATACGATACTTGCACTTTGACAGTCTTCAAATAATGTTTT GCCACTTCCATCAACGTCTCAAAATTACAACGAAAAATGTAAATCCCCTATCCATATTAATTATTATATTTAAATAATTA ATTTTTTATATAACAATGACACTAACTTTCTATAAATAATCCATAACATTATTTTTAATTTTTTCTTTTATAAGCATTAC CAATATGTATATTGATCTTGGTAACTGCTCTTACACATGTCAACTTTGTGCTTCTCTCTCTTGGTCTAATGAACGTCTCA AAAAGTAATAACCCTCCTAAATTTAACCTTTATTGTAAAGATGGAAAAATCACTTTACCTTTAATTGAAAAAACACCTCT TATATTAGACGAATTACTCAATTATCATGCAGATCAATAACTACACATTTCTGAAAAAATATTCGAACATATAATTCTAT GTTTGCATTTACATCATTTGGAGCTAATATAGAAACAAGTACCAGAAACTCAGATGGTCCATATATTTTCAAAATAAGTG GACAAATACATCATCATATGGGATCTTTACTATCAATAAAATTGAAAGATACACAAAATGAAAGGAGAATACCTTTTTGG AGGAAATTGAAATGATACACAAAATGAGATCTTTACTACCATGTATGGGATCTTTACAACTCTATATACATGATACACAA AATGAAATTGAAAATCGAATAGCATCGTTCTCATTCAACGATGAAACAAAAAATTTAACTTGTGACTATTACCCGCTGAC AAAATGCATTGTAAAAAGTCCTTATGACAATGTTATATAAACATATTCACATAAAATATCTGTACATAAACTAATTCTAT ACAATCAAAAGTACTAATTTCTTATATAACTTATGACCATTACCTGCTGCAATGCGCGGGTAAAATACTAG >DHH_16_2_Mno length=1412;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATATTTATATAAGCCTTTTAAAATAACAATTAATTAAAGATATATAAAATGTACTTTGCATAATTTATAAAATAATA GTACAATTGAAATAACAATTAATCAAGTAAAAAAAAGCGTTGATGAAAAAAGTAAGCTTAAAAAAATTTACATTCAATTT ATATAAACAATTTGAATATTTAATTAATAACTAATTTTTAAATTAGGTTTTGTTCTTCTTCAAACTTAAATAATAATTTA ACTCATAAGCCTATACTATTGACCCCAAAATAATATATTCTTCTTTCTTTTAATCCCTAAAATGATCTCATATTATGATC AACAAACAAATAGATAAAACAAAAGTTAGAAAAAAAAACGACCACGATCGAATAAGCGTATGCGTCATGTCATTTCAGAA ATGGACCAACGTTTTAACAAGACGATTAGTCAATATTCACATTATATCAATCAAAATAACGACCTTGCATCAACAACAAC TTCGCGGTCTATATTTGATATGATGCTTGCATTTTGACAGTCTCCAAATAATGATTTGTCACTTCCATCAACGTCTCAAA ACTACAACAAAAGATGTAAATCCCCTATACATATTAATTATTATATTTAACTAATTAATTCTTTACATAGCACTAACTTT CTATAAATAATCCTTAACATTATTTTCAATTTTTTCTTTTATAAGTATTACTAATATGTATATTGACCTCAGAGACTATT CTTACACATGTCAACATTATGCTGCTCTCTTTTGGTCTAATGAACGTTTCAAAAGTAGCAACCCCCTAAATTTAACCTTT GTTCTAAAGATGGAAAAATCACTTTACCTTTAATCGAAAAAAACACCTCTTATATTAGACGAATTATTAATGCAGGATCA ATAACTACACATTTTTAAAAAAAAATATTCAAACATATAATTCTATGTTTACATTTATATCCTTTGGAGCTAATATAGAA ACAAGTACTAGAAACTCAGATGGTCCATATATTTTCAAAATAAGTAGACAAATACATCATCTTATGAGATCTTTACTACC AATAGAATTGAAAGATACACAAAATAAAAGGAGAATATCTTTTTGGAGGAAATTGAAATGATACACAAAATGGGATCTTT ACTACCATGTACGGGATCTTTACAACTCTATATATATGATACACAAAATGAAATTAAAAATTGAATAGCATCATTCTCAT TGATGAAACTAAAAATTTCACTTATGACTATTACCCGTTGACTATTTATTACCTGCTGACAAAATGCATTGTAAAATGTC CTTATGACAATATTATATAAACATATTCACATATAAATATCTATACATAAACTAATTCTATACAATCAAAACTACTAACT TTTTATATAACTTATGACTATTACCCGCTGCAACGCGCGGGAAAAATACTAG