>DHH_15_1_Mno length=11714;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTAATATTATATATGAACAGGGAAATTTTGTAAATAAATATTAAAAGAATATTTATAATAATAATAAAGTAAGTTAAGC AAAATATATTACCTGTTAATATCTCAGTATTATTTATTCTTTGATATAGCTGGTCAAATTTTATGAAATAGAATTTGTGA AATGGGATGTGTGGTGCGTCTTCCATAATTGGAGTAAAGGATGTTGCTCGTGCAAATTAGATCATAGCACTGTGTGGAAC AACTTTGTATACTGATTTATTTTCAGTAACATAGAAGTTACTAATATTGTATATATTGCCTTGTTCAATTTTTTGAGAAA TATAGTCCGAATCTCGTGCTCGAATTGTTCCCTGTATTGCTTCATGATGTAAATAAATAATAAGAATAGGAATTTAATCA ATATTAACAAATGTTATATAAAAGAAAATGTAATATAATATTTTAAAATTTTAGTACCTCTTCATCAACCAGGATACAGT CAAGACTTATCAGGCGTCCTGTGACAAAATCGTTGTTTGTCCATATTCTGCAAACTCGTGCCTGTATTGTTTCATACACT TCATTTGGTTTCAGTGCACGAATAGGTGTAGTCATTTTTTTTAACCCTGAAAAAAGCAAATAAGATGTTGTTATAACGAT TTATATTTTTATTGAGTTTATTGTTAAAAATATTGGACTAAAAAAATTTTAATATTATGAAGAATACAAAATGATATATA TTTTGTATGTATTTATTTATATGATGTTATGTAGGATTTCTTTGTAGACAATATTTTTTATATGATTAGGATAGTTGTTG TTTGAATCATTGAGTAATATATATAATCCTTTTGGATTAGTAACTCTAGATAAAGCAACATATAACTGACCATGGCTAAA TATTTGATTATCTAAAAATAGTCCAACTTTATTCAAAGATTGTCCCTGACTTTTATTTATTGTCATAGCGTAACATATTT TTACAGGGAATTGGCGTATTTTTAAAGTAAATGGCCATTTTGATTCATGTATAGTCATTTCTATTATTGGAATATAAACT TTTTCGAAAATATTATTTGAAGTTATGATCTGTCCTTCGATTACTTTATTTGTTAATTGTGTTATGATAAGCCTTGTTCC ATTGCAAAGTCCAGCAGATTGATTTAGATTTTTTAGAAGCATTATTGGAGTTCCAAGTTTAAGATTTAGTTCGTGTGGTG GTAAACCGTTGAAATTTAAATTGTGTAAAAATTCTTGAGAATATAAGAGATTTAGTTCTTATATATTTTCTGACGAAGGT AGTATTATATCATAACTATAATAAGTTTTTACCTCGTTAGGTACTAAGGATAATATATAATTATTTATATCGTCAGCAGT TTTATTTTTCGGTGTTACAATCGCGCGCTGTTTTAGGTACTCAATGTTATTAAAACTGTTGCTAAAATCATTGTATATCA ATGTTGTTATTTTGTCAATTGGATCTAGGTCAAAATGAACAAAGTATGTTTCTGGTATTTTTATCCATGTAATATCCTCA TTTTCTAAATCTTTTATTCCTTCGGCAATACCATTTCCTATGTCTAATGTCCATTTTGAAAAGTTTTCAATCTCCTTTTT TTCTTCTGATGTTGTATTATAATGTTTTAATCGCATATTTTCTGTTAATGTTAAAACCTGAAAGTGTGGCCATAAATAAG AATTATTGATGCATGCATCTATTATGTGTTCTTTTGTTCCTGTGGGTAAAACAGGTAGGATTTGTCAAAAATCACCGCCT AGAATAACTTTCATTCCACCAAATGGTTGATCAAAATTGTTTCATAAGTCTTGGAGTGTCTTATCTAATGCCTCAAAATA ATATTTATTAGTCATAGGTGCTTCATCCCATAAAATTAATGATGTTTTTTCAATTAAATGTGCTAATTAAGTTCTTTTTT TTTATATGACATGTTGAAAATTTGTCTATTGATAGCGGTATTCAGAATCTAGAATGTGCAGTTATTCCTTTAGGCAATAA TAGTGATGCTATTCCTAAAGATGCGACAGCTAAAATAATTTCATTATTAGATCTAATTTTTGTTATAATTGTATTCCACA AATATGTCTTTCCAGTTCCTCCATGACCATAAATAAAGAATAAGTTATTTTGTTTATCAGTAACAGATTCTAAAATTTTA TGGTAAATAATTAACTGTTCATTGTTTAACTTTTCTACTAATAAAGAATTTTCTTTTTCCAATTTATTTATATCATAATT AAGTTCTTCTCTTAAAAGTTTATTGTTCAAATCTTCTATTAGTGAACCAGTAGGAAGTGGTAGATTAAAATGAGCCAAAG TTGATGAATTAAGATTTAATAATTTTTCTAGTTCATGTAATATAAAATTATATAATTCATTTTCTGGTATTTCAAAATAT GGGTTGTTAAAAATTGTCTTAATTTTGTATAAGATATCATCAGTCATAAGTTTCCAATTTTTTTCAAGTAATTTAAGTGG GTTATTTACATTGCAAAATAATAGTATAATAATAAATAAATGTTGTAGTTGTGACGACGTAGACCAAAAAAATGCCTCTA ATATGGATTGTTCCCATTCTCTATCATCTCCTAATAAGCCTAATGCATAGCATGCTGCCTGATATGTTTCATATGTTATA TTATCAATAGTTCGAAGATTTTCATGGCTTGTTATTCCTTTTCGATGATTTAGTAATAATTTTAGATAATATAATTCTCC AGAATTTGGGTGAATATAATATGATCAGCCTATTGTATGTCCTATTTGTCTAGAAGACCAGTATTTATATCGGCTATTCC AAACATATTTAGTTAGGAATTCATTATAAGTTAGATTTCTAGCATTGATGTCAGTTTTATTTGTTTCCATCCATTCTGTT AAAGTTGTTTAATGAATATTTGGTTGTTTTATTATATCGGTTAGACGTTGGTTTGATTTGAATGTTATGTTTTACATTTT TGGCAAATGTATTGATAAACGTTGAATGGCTGGGTTTCTATGATGTATTGGATATTCATATAAACGCCATAATGCTTCAT AAGGTGTTATGTATCTACAATTAATATAGTTTTTTATTTCATCTATTTCTTCATAAATTGTTTCTCCACACTTTTCTGTA TAAATATTTTCTTCTATGACTGCTCTTATTCTATCAGGTCCTTTTGTTAGATATTTAAATAAATATTTTATAAGCATTGA CTGAGAACAGATTTCTACATTAATGTGAGCATTATATTTAAGACATAGATCTATATTATGTGGAACGACATATCTATTAT CTAATTTAATATCATCCTTTTCAACATAAAAATTTGTATTTCTTCTTCTATAATTGACAAATCTGTTTTCCTCAATATAT GTTTCATTTTGTATTTGTCTGGGGAATTTTTTTGAACATTCCGAACTTTTCATACATTGAGCAGTTGGTTTTGCTATTCC ACACGGTCCATGCATCATAAATTCGGCAACAACATTGTATTGTATTTTGTTTTTTTAAGGATCAGGAATTTCTGCGGAAA TAAAATTATCAATTTTTGATGGATCATGTAGTTTATCGTCAGTATGTAACCAAAAAAGAAAATGGCAATGTGGCAAACCC CGTTTTTGAAATTCTACTACGTACAGATCTATAAAAGTTGAACAAAAAATTTGTTTTAGATATCTATAGGAGAAATAATA AATAAAATTATTTAATATTTATAGATAAAAAGGATATAGATTTGGAAAAAATGTACTAACCTGCAACAATTCTTCCAAAA AAAATTTCGGTTTTTATTGTTGATAAAAAATGTTCTAATTTCATTTTTAAAACTCTTACAATAATATCAGGTCTATCTGC AGAATTAGAAACAGGTATTTTCATTAAAGCTCTAGTAATTTCAGGCCATTTTGGATTACATGTAAATGTTATGAATAAAT CAGGATTTCCATAATATCTACAAATTGTCATTGCATCATGATAGTTTTGTATCATATATCTAGGACTTCCAGTATGACTG GAAGGAAGAATAATTCTTTTACCTATTGCTTATGCAATTGTATCTCCTTTTGTAATAGCATCTTGAATTCCTTGATAAAA TTCAGGCATATGCATATGCATCAACCACATATTGTTGTAATAATCTTCCACTTCTAAATAGGATATCACAGTGATTTTTA TGTTCTAGTAATTGATAACAATAAAATTCTCTCATAGAAATCCTTTTTCTTTTGTATGTGTTATTTGTGTTAGCTACATT ATATTTTAAATCTGTTCTATAACCATCTTCTCCATAAGGAAATAATAATGGATATTGAAGAGACATATAAGATGGATGTA ATTTCATGATTCTTTGTAAAGAATTTGTTTTGTCCTCAATTATAATGTCTCTTCCTTGTTCATATTCACCAATATCTCCA ACTATTAAGCAACCTATATCATTTGAAGTTGGTAATTCATACTGATTATTATCTGTATTTCTTCGATTTATAAGTCTTAG TTTCATAGATGGTAATTTATTTTCCTCATATCTATCTCTTATCATTCGGAAAATTTTTACTAAATTATTTGTATTATCTA ACATCGTAATTAAATGTTCAATTATTATTTTTATTAAATCTGTTGATTCATTTTCAAATGAGAATGAGGTCATTCGATTT TCAATTTCATTTTCCGTATCATATATATATAATTGTGCAAATTTAGGAGGGTTATTATCAGTTGGAAGGAGAGATCCTAT CAAATGGTGTATTTGTCCACTTATTTTAAAAATATAAGGGCCAATGGAGTTTTTTGGGAAATTTTCTATATTACTTCCAA ATGATGTAAATGCAAACATGGAATTATAAATTCTAATATTTTTTTGAAAGTGTGTACTTAATGATCCTCCATAATAGTCT AATAAATTATACAGTGTAGAAGGAATATGTTTAATAAAAGGTATTCTAATTTTTCCTTGTCTACAGCAAAGATTGAATTT AGGTGGCTTACTTCTTTTGATTCGTTCATTAAGCCAAAAAAGAAAGCCACAATAATGGCAGATATAAGAACGGTTTCCAA AGTCGATGTACGTATTAGTATCACCTAAAGAAAAAAATTTATATCAGTTTGTGAAACTGTTAAATAATTTTTTTTTTCCT CTTGAAAAAATTCATTATTTAGTATAAGTAAGAAAATTACGATTTTGTGTGTTGTTTTCAAATGTTGATGCACGAACTTG TTCAGAAGATCTGCTTTCAGTTTCAGAGATTTGTTGCATAGGTTGGCCTTCATTTTTAGACATATGTAGTAGATGTCTGT TTTCAGTTTGGGTCATATGTTGCATCACATCAACTCTGGATCGAGGGATCAGTGTGAATAAATCTCTTGTACCACAACTT GAATTACCGGAGTAATCAGTATTTACAACTGTTGAATCCTCGTCCATATGTGAGATGATATGACGTACACGGTAGTTAGA TTTTATGGGCGTCTTTTTAATTTTTTTCTTCGGCTCCATCTGTGTATTACAACAGATTATGATTCAATAAATTATTTTGT AAAAGTTATATTTATGTTAGAAAAGATTATGGCATATGAGATTATATGATTACTATATTGAACAAAGCAGTGTAAACAAA TATATGTAACAAATAAAATAAAATAAATGGACATAACATGATAGGTAAATATTTAAGGTATTTTTTTAGTCAATGAATGA ATATTATAAAATTATTATGATATAAAACAATATAATATATATAAATAGAATATATAATCTCAGGAATAAAAGTATTATAT GTATAAATAATTTGTAATAATAATATCGTAAGTAAAATATGAGGAAAAATTAATTGCTTAGAATCGTACATAGTATTCTA TAATATTTTACTATAAAGCAAAAGTTATAAATGTTTTTTTAGGCAAAATAAATAAATATATTTAGTATTATCAATAGCAA CCATATCTAATCACATAAATAAATATTGAAATAATAAAGATATAAAATTTTAATAATACCTGGAACGTTGTGTAAGTAGC AAATTTAAGCTAACCAAATCAGGCTATATATAGAAATGATGCTTTGCTATGAGACAGAGTAGATAATGATTGATTTTCAA CTGTTGCAGTATAATATGGAGATAGGAAATGACCAAATCTGCTTAAAAAGAACATATTAGGATAATATTTTATTGCCACA TAATTGTTATAATATGTTAAAAATAAAATTTAAAAAGGGAAAACATATGTATTTTAGAATTGAGCTACCTAGAATAATAT GCAACATACAGAACAATAAATCAGGAAAAAACAAAGGGAAAAAATCGAAACATATTTAGGGAAGAAAAATTTAAATAAAT TATAAAATAAAGGAAAAAGAGGTTTCTAGAGAAGGGAAAAAAGGCAAAATTATAGGATGTTAAATGATATTATTATGTCA AAAACTATTGCTCTATACAAAATAGGCTGTGCCTAGTACAAATGGCTTACACATGCATTTTTTTGTTGCTGTTTGGGGTA GAAAAGTTTGAGGTATTATATTTGTATTTTGTTAGTTCCTTTTTGTAGGTGTTATTTTGTTTGTTTTAATAGATGATAAA TGTTAAAAAAATTTGGGTTACTGTTTCGGGCCCAAAATTTGGGCTGTTATATTTGTATTTTGTTGGTTCCTTTTTGTAGG TGTTTTTTTGTTTGTTTTAATAGATAATAAATGTTAAGGTAAACAAATAAATGTAATGTAGTTATAAACAGTAATATACA CAATTTTACATGTATTAAAAAGAAGGGAAGCTATTATTGCTCCCTGAAAATAATTATAACATAATAAGACCAAAAATTTA TATACAAATTTATATCTCAATTACATCATAAATTTGGACATAAGAGTTATTTCATAGCCCTGCAAGGGAATTTTTGGATT TCCTCTTGTAATGTTTCCTCAAACAAACTTGTAGCTTATTTCTGGGTACATGGTAAGAAGAAAAGGAAAAAAACAGTGTG AGAATTAATTTTTTGAATATAAGGAACAAATTTTTGCATAAACAAAGATAATATTTTGAAACAAAGCTCAGACCGGTGTA TAAGTACAAAATGGTAAGCAACGGTGGAGAAAAAGCAGTAAATGAGTGAAGAAGCAGAAATTAAGAATAGTCAGGTACAG GCAATAAATATTAGCAGCTGCAATATAAATAGTAGGGAATGATCAAAAGTGAGCTAGAAGAGGAAAAATGTCTACCACAG GTAAGGAAAACAGAAAAATACAAAATGAGATTATATATATGACATATAGTGATATACACAACTGCCACACATGTTATGAA GAAATTTATGCCATAACTAAGGAAACTGTATATACAAATGGTTCAGGTTATATTCAAGCACTGCAAAAAATATATACCAA GGGTAATCTAAACAAAACATGGCAATATAGATGGCTACCGGCAATATTATCAGGGAATTTATGCCATAAGTAAGACATAA CAGTATAGCCTAGATTAGCAATAAGTAATTGAAACAAAAGCTGTTTGCTATTAATACTATACAGCATAGGTAGTTGAAAC AAAATCCGGCAACATACATGGTTACCAGCCACGTGTTATTAAAGGCTTTATAAAAATAAAATATATTGGCATAATTCTAA AATAGTAAGGGGAACATGAATGATAGGCATGTCTGTAAGAACTATTACCCAGTAAATGTTAACAACAAATGGTGTATAAC ATCATCATAACCAGGGAAAAAAATGTTCAAATATAAGAAACCAAGTTTTTGGTAAATAAAGGCATTCGGTTGTAACAAAC TTTATAACACTGCGGTAATATCAAATGTCAGTTAATAAATTAAGAGTAACAGTAAATTATGCAAAATACAATGGAAAAAA AACAGAGTAAACAACAGAAGAAACAAATGGATATGTACAAAATAGTAGTGTAGACAAAAAGCAAATTTTATAAATACAAA TATATATAATAAAACTAAAACAAATGACCAATTAAAATATATTGGCATAAATCCCAAATAATAAGGGCAACATCAATGAC AACCATATTTGCAGTAAAAATTACCCGGCACATATTAACAACAAATTAAATATAACATCATCATAACCAAAAGAGAATAA GGTATTTTAAAATTAAAAAACTGAATTTTTGATAAAGATACGCGTTATATCTTAATAAGATTTAGGAAAGTTTGCAAACA TAAAATATCAGGTAATCAACTTAGAACAGAAACAGGTAACCGAGAGTAGAGTACAGAAGGAAAAAAATAAAGTGCAGTAT AAAACATTTCATATAATGAACAAACATAACATTACAAAATTATATTCCAGAATAAAGCAATTGAATTAAACTGAAGAAGT TATTACCTGATTGAGCAGACCACGGGCAAAACGATAGATGAAAGAAAGCAACAAAAATTATTGAGCAGCAGGAANNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNCGAAAATTACTGAGCAGCAGGAATAGAACAAAGATATATAAAGGAAGCGATAAGAG TAGTAAGAAACAGGTAGTATTATTATGGTCTTTAAAGAGTGGCAAAGCGGAGATAACAGAATATGGTAGACAATATAAGC TGAGAAATGTAGACAAAGCAATAGTAAAAGAGTAACATCCAGTATATATAGAAAAAGTTACCCATGTCTTGCTTAACCTC GGATACAAATCCCTACAAACAGAAACCAATAAAAGTAATGATTAGTTTGCAACAGCCATCACAATGCATGAAAAGCAACG CAAGGTAGAACCAACAAATAATAAACACTTATTAATCGGTTAGATATTATACAAAATGGGAAAATTAAAGATACACGTGT CAAAGTAAAAGATTAATATAAATATCACCATATTTGGAGCATGACAAATATTATACATTTGTTTTAAAGGGATTTTTTTT TGCTTTACCAATATAATATGCGAATAACAAATTAGGAAGGAAAAAAACAAAACACCATACAAAAACAAACACAGATATAA AATAAATAACCCAACAGCCTAAAAAAAAAGTAATCGAAACATAGATTTAATAAACACAAACGAAATCATGGAAGAAAGAC AAAAATATTTAACAAAATGAACTACGGACAAAACTAACAACCTAATGAAAGAAAAAGGCACCATGCATATACAACGAAAG CATGAAAATAAAATATAAAACATCTATGAATATATATATATATATATATATACAAACAAACAAAAAATACGAATAAACCT GGCGACGAAAGGAAAAGAAGGATCTAGAAGGTTGCAGAAAAAAGGAAAATAAGAAACGAAGAAATGTGGCAAAAAACCTA GAAAAATATACAGATCTAAAACATTGCAGGGAAGGGAACAAAATTTATACAAAAAAAAAATACAAATAAACCTGTCGAGC AAAGGAAAAGAATGATCTAGAAGGTTGTAGAAAGAAGGAAAATAGGAAACGAAGAAATGTGGCCAAAAACCTAGAAAAAT ATACAAATATAAAACATTGCAGGGAGGAAAATTTTTTTTTGACAAATATAGATCCAGAGACAAAAAAAAAAAAAAAACAA ACGCAAATCTAGAAAATAATAAAAATGAACGAACCCAAAAAATAAACCTATTCCTCTTCAATCTAGCTACGGAAAAATAA AAACAAAAGTAGATCTAGAAAAGGAAGAAAAATTCTAAAAATGTAGCAAAATAAGGAACACGGCAAACAAAGAAATGTGG CCAAATTTTTAGAAAAATAAGTAGATCTAAAAGGTTGCAAGAAGGAAAAAAACCAAAGGAAGAAAATAGATTCAGGAGGA AAAAAAATCCCATTCTCAGTAAAAAAAAAGGGCGTTGAATATTACAGGAGCAAATCAACAGGAAACATAAACGGCAACAG GAAGAAATAATGAAAAAATGACCGAAATCAACAAACGAAAAAAGAAAAAGGCTAGATCTAAAAGGTTACGGAAGGGAAAA GAAGAAAAGGAGGAAAATAGATCCAAAAAAAAAAACCCCAATTTCAGTAAAAAAAAATGGAAGCTCAAGATTAGAGAAAC AAATCAACGGAAAACATAAATGGCAACAGGAAGACATAACAAAAAGATGAGCGGAATCAACAAATGAAAAACGGGGATAA AAAAACCCTGGCTCAATTTTAGAGAAGAAGAATCCAGAAAACTTCGGAAGGAACCAGAAGGAAGCAGATGAAGGAGAGAG AGAGACAGAAACAAAAAAGAGTGAAAGAAAGTGAATAAAAGCAGAACAAACGAAATAAGCAAAACATCCAATAAATGACC AAAATGGTCACAGCAAATAAACGGGCAGGAAACTAGAAATGAGGGCAATATCGTAATTTTATAAATGGGACATAACGGTA ATTAAAATTTCATCAGAAAAAAAAAAGCATGACTAAAACAGAAAAGACACTGTTCATTACACTGTAGCATGAACATTGAA TCCCGCCCTCTTTTTTAGTATATGTATAATATATATATATATATATAAATAAATCGAGCAAAGGAAAAGAATGATCTAGA AGGTTGTAGAAAGAAGGAAAATAGGAAACGAAGAAATGTGGCCAAAAACCTAGAAAAATATACAAATATAAAACATTGCA GGGAGGAAAATTTTTTTTTGACAAATATAGATCCAGAGACAAAAAAAAAAAAAAAAACAAACGCAAATCTAGAAAATAAT AAAAATGAACGAACCCAAAAAATAAACCTATTCCTCTTCAATCTAGCTACGGAAAAATAAAAACAAAAGTAGATCTAGAA AAGGAAGAAAAATTCTAAAAATGTAGCAAAATAAGGAACACGGCAAACAAAGAAATGTGGCCAAATTTTTAGAAAAATAA GTAGATCTAAAAGGTTGCAAGAAGGAAAAAAACCAAAGGAAGAAAATAGATTCAGGAGGAAAAAAAATCCCATTCTCAGT AAAAAAAAAGGGCGTTGAATATTACAGGAGCAAATCAACAGGAAACATAAACGGCAACAGGAAGAAATAATGAAAAAATG ACCGAAATCAACAAACGAAAAAAGAAAAAGGCTAGATCTAAAAGGTTACGGAAGGGAAAAGAAGAAAAGGAGGAAAATAG ATCCAAAAAAAAAAACCCCAATTTCAGTAAAAAAAAATGGAAGCTCAAGATTAGAGAAACAAATCAACGGAAAACATAAA TGGCAACAGGAAGACATAACAAAAAGATGAGCGGAATCAACAAATGAAAAACGGGGATAAAAAAACCCTGGCTCAATTTT AGAGAAGAAGAATCCAGAAAACTTCGGAAGGAACCAGAAGGAAGCAGATGAAGGAGAGAGAGAGACAGAAACAAAAAAGA GTGAAAGAAAGTGAATAAAAGCAGAACAAACGAAATAAGCAAAACATCCAATAAATGACCAAAATGGTCACAGCAAATAA ACGGGCAGGAAACTAGAAATGAGGGCAATATCGTAATTTTATAAATGGGACATAACGGTAATTAAAATTTCATCAGAAAA AAAAAAGCATGACTAAAACAGAAAAGACACTGTTCATTACACTGTAGCATGAACATTGAATCCCGCCCTCTTTTTTAGTA TATGTATAATATATATATATATATATAAATAAATAAATCCTGTACTACAAAAATTTTTAACTTTTTGTATAATACAATAA TATTTTCTACGGCAACGCGTGGGCTCTCAGCTAG