>DHH_14_1_Mno length=12279;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCCTCATATTATTATACATATACTAAAAGAAATGACGGGATTCACTGTTCATGCTACAATGCTATAAACAGTGTCTTTCC CGTTTTACCCTTACTTATTTCTTCAGTTAAATTTTTATTCCTGCTATGTCCTTTTGAAAGTTACTATAGTACCCTTATTT CAATTTCATTTTTTTCAGTTTAATCTGACCGTTTTGGTCATTTGCACTCAAATTGAGTGTTTTACTTTTTTCCTTTGCGT TTGCTCCCTTCTACAACCTTCTACATCTTTTATTTTTTTTCTTTGTTTCTGGAGCTTTTCTTCATTCCGTTTTCTACCTT CTGCAACGTTCTGTCCTCTCTCTCTCTCTTTCGGTGGATTTCTTTAGAAACTCTGGTTCTCTTCTTCGGTGCTTCTATTT TTTTTGCCTTTTGTCATCTGATTTTGGTGATAATTTTGGGCTTCCATTTGTTCTTCGTCGTCGGTTATCTGGGCTTTGGT TCTTCGATTTCGTTTGGGCGTTTTCTCTAGTTTTGATGGACGCTTTTTTTGTTCAACTTGGCTTTAGTGGAGGGTTTTTC GATTCCTCTTGCCTACTTCTTCATTGGGTTGATCTGCGATTTTGGTTTGGTTTTCTATCTCCTCTTGCCGGAGTGCATGT TTTGTGCTTCCCTTTTTTTCCCCTTTTAATATTTTTCCCTTCGTTTTTGTTGGTTCTGTTCCTTCGTTTCTTACTTTGTT TGTTTTGCAAAATTTTTATCTTCTACCGCTTCTTCTCTTCATCTTGATGTTTTCCAGTTTTTTGGGTTATACTGTTCTGT TCATTTAGGGTTTCGATATTTAGAGTTAATCTCCTTTAGTATAAGTATTTATTTATTAAAATCTTCTTTATACTAATTTT CTTTGGTTAATTTTTGTAAATGTTGATTGTAATTAAGAGTTTTTTTATCTGATTTTTCTTTGCGTTTTTTTCTTGCAGGG GCATTTTAGAAATGTTTTGTCTTTTAATTTTTTAAATACATTCAGCGTGGAAATCTGCATAGCTCATATTCAGTGTAGAA ATCTGCTGATTCCGTAAGTTTTTTTTTATCATAATAAGGTATATCAAATCTTTATAAATTTTGATGTTTTTCTTGGGGTT TCTTTTTTATGTTTTTTCCTCCTTTTTTCTTTCATATTTTTGGTAGATTTTTTGGTCCTTTTCTTCCCTGTTTACTTTTT CTATAATTTTTTTTTCTTGTAGGGGCATTTCAGAAATGTTTTGTCTTTCGATTTTTTAAATACATTCAGCGTGGAAATCT GCATAGCTCATATTCAGTGTAGAAATCTACTTATTTCGTAAGTTTTTTTTATCATAACATCTTTGCTGGTCAGTTTTCAA AATGTTCTTTGTGTTCCATTTTGAATCACTTTCGTCCTTATTGCAAATGTATCGTTTTGTCTTCAGTTTTTAACTTCTTT ATTTGTTCTTATTTGTGCCCTTTTAGTCGTTTATGTGCAAATAAAGGTTCCAAGCTATTTTTCTTTTTTTGGTCTTTTGG ATAAATCCTTTAATAATTTAGCTCACAGCCAAATAGATTACCAGGTCATATTTCGGTTACTTATGATATATATCATTAAC AATAGAAGATAAATACCTGAACCAATTATTTAATATACAATTTTCTGGTTTCTTTATCTTTTGTTGGCAGTCAAATACAT TGCTGAATTGTATTTTTGTTATTTATATATCAATTTCTATAAATTCTTTGTCCCACTTATTTAACTGAACAATATGAAGA CAGTTTTTTTCTTATATACATATGGAAATTATATATGTGATACATTTATCAAAGTAAATGTATTGTAAATAGTGTTTGAT CTTCTTTCTTTTTTAGAGCACATTTATCATATTATATAGTCATTGTATGATAATATATTTTGTTGTATTTTGCTTATTTG GAGTAGATTGGGTGTGAGACATTGGGGCAATATGCTAGAATGACTATCCAACAAAGTGAAATTAGCAAAATGACCTTCTT CTATTTTTTATGAAGAAAGACACTTAATCATTCTTTGTAAAAAGATGTCATTTTGCAAATAAAAATTTTTGAAAAGTTAT TTTACTAATAAAACTTTTCTATTGAGTTATTTTTACAAATGCCTCGAGACATTGAACACCACATGTATTTTGGCTCTCAA TCATTTACTGCTTTGCTTGATTATCAATTGTGTGTTGCTTTCGCTTGCTATCGCTATATCTTTTTTTTCTCTGTATTCGG AATTGGTTGGCTGACATTTCAAACTTAAACGAGTGCTTATAGCATTCCAGGTATTTTTAATAAATTTTGCCCAGATTTTT TACATATCTGCTGCTGATGTTAGATATATTAGTATGATGTGATTGTATCAATATGTGTTGTTTCTGTTTCATAATATCTA TCTGTTCATAGCTGATTTTAATATACTGTTAATAAACATTACTATTATATATTGCTCATAGTGATTTTGTTATGTTGTTA ATAAATATTAGTGAAATATGTATTCTTTCTGCCCTTTTTTTTTTCTTTTTTCTCTGTCTTTGATTACTACGTTTTGTTGA GACATTAGCTCCATGTTTGTTTCTTTTTTACCTATATAGTTTCATATACTTTATTGGCTATATCTCTTTTCTTTTTTAAT ACTTTAGCCTTTTTGATGAATACTTCATTTAAAACTTATATACACATACATTACTTCTCTTTTTTTGCAACTGAATTTTA CCTTTTTGTTCAGCAAACATATTTTTGTTTTACCCTTCTTTTATTGTAGCAATGATGATAATAAGCAATCTTAACTTTTT TAATTTTACATATGTTATCCGAAAATTGATGTGAATACATTTTTCATATTTTCATTACTCTTTTACTCATTTCACTTTAG CAAATTTTTTTTCCTGCCACTTTATAATGGTCTCTCTCTTTGTTTTACACCTATTCTGGTGCTTTTGGCCTCTTGGTATT ATTATTTTATTCAAAACTTATTTATACATGTATTACCTTTGTCTCTCTGTTAATACTATTTTAGGTTTTACTATTCTATT TAGTATTCGCTCGTTCATATATTGTTTTTCCTTTTATGTTATTCAATTCTTCTTTATTTACAATTTTACTTATATTAGGC TTCTGATTTTTTTTTTTTTGGCTTTGTTGTTTGATTTTACAATCTTCCCCTTAGATTTTTGTTTCCACATTTGTTAGTTT ATTGTAGGCACTAACAACCATATGTTTTTCTTCAATCGAATCTTTTGTAATGCATATATAATATTATTACATATACTAAA GAAGAATCCAAATTCACTGTTCATTGTATAGTGTTATGAATATTGTCTTTCCATTTTTGTCCCTTCTATCGCACATTGAC CAATTGACCCTACTATCCTTTTTCATTAATCTTTTTTTCTCTAGCTGTTTTGGTTTATTATTTCTTATGCTTTTATGCAG TTACCGTAAGTGTTTTTTTTTTAAGCCAAAAACACTTACTGGATAGCCACATTTTAGTTATAGATATATATTTCAATTAT ATTCGTCACATATTATTGAAAAATTTTGATAACTGAGCTACAATTATTGTAAAAAAATTTTATTTTATTCATATTTTTCT TAAAATATATTTTGTTTTTTTTTTTCATTTATTTGTTTAGTTGTTTTTATTCTTACAAGACTTATGACTTACATTTTTTA TTCTTACAAGGCTTATGACTTATATTTTTTCCTACTTATACAGTTTACGTGCTCAAATTTTGTTACAAATTAATGTCAAT CTCTTCGGTCATCTCTGAAGAAAAAAAGTATAAGGCATAGAGATATGAATTTATTTCGCAGCCCCTGCAACCCTTATTTT CCTTTTCCTCCTCGATTCTCTCATCTCCTCAGCCCCCTTCCTGCGACCCTTATTTTCCTTTTCCCCCTCGATTCTCTCAT CTCCTCAGCCCCCTTCATTTGCTCTCTATCTGTTTTGTGGCTTCCTCTTCGTGTGATTCTTCTTTCTCGCTCTGTTTTGG ACGGGATGCTGCTCCTCATCCTTTGGGGTTTTGGAGTGTTGATTCTATTACTGAGATTTGGGTGGAAATGTGGGGATTTT ATCCCTTTTCCCTTTTGGATTCTTCTGTCGTTTTTTATTTCTCAGGTGATTTGTCTATAAATGGAGTCCTGGCCTCTTTT GGTTTTTGGGTTTGCTTATTCTTCCTCTTTTTTGCTCGATTTCTCTATTTCGTTCGGCGATTTCTCTGTAAATGGAGCTG TAGGGTCTTTTATTTTTTTGTTTTTTTTTTATTTCTTCATTGCGGATGCTCCTCTGGCTTATTTTTGTTGCACAGTGTGT ATTTCTCCTTTGATGCATGCCATTTTGGATAATTTTTTCCTTTTTTTCTTTTGTCTTCTTTGTTGGTTTTTATTTATTTT CTCCATGTGATTTTGGCGGATGCTGTCCTGATTCATTTGGATCTTGGTGCATGTTTTTTTGCATTTTCCTCTCTCATTCA TCTGGGTTTGGATTTTTTTTTCGTCTTTCCTTCTGCCTTCTTCGCCTGTTTTTATTTGTGTTTTTGGTTTCTTTTCGTCC TGTGATTTTGGTAGCCGCTGTCCTCATTCATTTTGGTTTTGGTGCAGGTTTTTTCGATTCATCTACATTTTGGTCGAGGC TTCTTCTATTTTCCTGGTTTGCCTTTATGTTCATTTAATTGTTGGTTTTAGATTCAACTTTGAGTTTTTTTACGCTTTTG GAGGACTACATGTTTTGTGCTCTTTTTCTTTCTTCGTGATTTTATTGCTTTTCCCACTGGTTTTGGTACTTATTTCCTTA TGTCGCTGCTAGTCTGTTTAAATTTTTCAATATTTATAGAAATGTGTTATAATTTTGTAGTTGTTGACAGGTACAATTTT TGAAAAATTTTTATGTGCTGCTTTATTTATCCCCTCGATTGATTCTTTTCTTCAAAAAGTATCTTCTATGTAGATGGTTC CATGTTTTTTTTTAAATTTATCTTGGTCTTCTTTTTTTCCTATTTATTGTCTTCATGATTCGTGTTGTGGACGGCACTGA TTTGTCTTGCCATCTTGCTTAATTGTACTCATTTTGCTGCAGATGCATTAAATGAATCTTCAAAAAGAAGCTTCTATGCA GATGGTTCCATGTTTTTTTTTTTTTAAATTCATCTTGCTCTTCTTTTTTTCCTATTTATTGTCTTCATGATACGTGTTGT GGACGGCACTGATTTGTCGTGCCACCTTGCTTAATTGTACTCATTTTGCTGCAGATGCATTAAATGAATCCATGATTTTC TGAATTATCTGTAGGAGTTAAAAAAGCAGGGAAAAAATATATTATGAATTTTTTCCTTTTTATTTCTTTCCGTTTCCCTT CCTTTGATTTCATTATTATACTGATATTATATTTCTTTCCTGTTTTTCTTATTATAAATTACCTCTTTCTATTATTGCTT AAAATTAGGGAATTTTTGTTTACTCTTTTTCCTTTTTCTTAATGCAAATTAAGTCTTGCATTTATTACTTAAAATTGGTA AATTTCTGCCCTATTATTTCTATCCACCGACTTTCAACTTTTACGTGTAATGTTATTAGGGGCTGTGAACTGTTTACATT TCTTCTTTCTGTTCTTTATCTATAAATGATGATGCACCTGAATTTATTACCTATGCCTCTGTCTTCTTTCCCTGCATTTC AGACTTATCATCTATGCCTCTGTTTTTTTCCCTTGCATTTCACCTCTTCCTCTCTCTATTTCACTTTCCATCATTTACTA CTTTGTTTCGTTATTCATCATTTAATGCCCTGTTTGTTTGTCCCTGTGCCTTTTTACTCTTTCTGCTTGTACTCGGTTGG CTGATATCTCAGACTTAAGACAACACTGTCCCAGGTATTATCTATAAACCCTATCCATAACTTTTTAATTCCTCATGCTG ATATTAAATATATTGCTTTCCACTGGTGGCATTAATTTTTATCCTTTGCATTTTATTAGCTATATTTATTTCCCTTTATA TCTCCTTACTATATAATGCTGATATGTTCACTCTTTCTTTATTTGTTTCTCACAAACTCATATATATATATATACACACA TTTATTTAACATATTTTACTCTTGGTAAGTTCTTTTTGGCGGTGATGATGAGTATAATTAATATTTACATGTTGAGTTCT ATGTAATTTGTTCAAAGATTGCTGTGAATATCTATTTTTTACTTAAAATTCAGCTTTTATTTATTGTTTTCTACAAAGCT TTCTAGATTTTTCAACCTTTTTCTTTAACAGAAAAACTTATTCTGCACCTTTTTCCCTCTTGCTATTTACTGTTTTATTA AAAAATTGCTTATATACGTACTACCTCTGTTTTTCCACTACCGAGCCTTGGCTTTTCCATTTTGCTGTTACCATTTGAAA AAAAAAAATTCCAAACTGTCCAATCTTAAAAACTGTTTATATATGCACTACCTCTGTTTTTCCACTACTGAGCCTTGGCT TTTCCATTTTGCTGTTACCATTTGAAAAAAAAAAGTTTCAAACTGTCCAATTCTTTTTGCTTTTGACTGTTTCATTCAGG ACCTCTTTGTATATACAATACGTTTCTTTTTCTGTTACTCACCTTCGGCCTCCTAATTCCATTCTTATCATTTCACACAC AAAAACTTCCCTGCAGAGAAAAAAAAAGCAAAAGACAGGCTTTATTATTTCTTTCTTCTCTTCTCCTTATTCTATTCATC ACATTTTTATTCCTCTATTTGCTATTGTTTACTATCTCTTTTTTCTCTACTTTTCCTATTTTATCATATAATCTATATTA CACTATGCCTCTTATGTTGTTTTCTCCTTTTTTTTGGCTTTGTAATTAATTCACCTGGTAGTCTTTGAACAACTTTATAT CTTACTCAAGTTACCTATTTTGTGTCGCATCCAAATTATAATTTGTGTGATAGATACAATATGTCATCCCTTTGTGCAGT TGCCTTAGTAGACAGCCACAATGTATTTGTCACATTGCTGAAAAGATTAAATACCTGAGCCACCGTTCTTACATAAAGAT ACTGTCATATTTATGTTTATTTATTTTTCAGTCCTTTTTTTCTTTCCCTTGCCCTCCCTACTTTATTTAGTCACGTTTCT ATTTCAAAAGGTTTTTTACTTTTTTTTTATTCATAATGTTATTCCTTCACCGAAGACTATTGTTGATATTTGGTGCTCAT ATGCACCACTTTACCCAAAATCTGAGTGTTTCACCTATTAGTATCAATCTCTGCCCATAACTTTTGAACTTTTTATATTG ATATTTTCCACTACGTAAAAATATTATTATGCCTATATCTGTTGGTTTTTTAAATTTGTTTCCCCCGCTTACTTATTCAC TCATTTGCTTACTTGATTATTTGTATCTTCTAAGGTCTATTATTGCCCATTGCCCTGTTTTGCTGCTTTCGTATTGGTCA TTGCTCTTTGACCTTTAGTTCGTTGACATTCCGGATTTAACGTGGGATTTATAGCGCTTGAGGTACTTCTGATATTTTAT TTCGATAACTCTTTCATCATATTTTTTCCATCTTTTATCCTCACTGATTTTATTGCATTGTTTTACTCATTATCTTTTAT TGTTTTATTTCTCTTAAATCTGGCTACCTTTGTTCATTACATTGCACATTATATTGCCCTTTCATTTTTCTGTTCTTTTG GATTTTATTATAACTAGCTTGCTTATTACATATTATTCAAATTACTATTATATACTTGAGCCTCAATTACAATATATCAA AACTTTGCCATATTTATCTGTTATCATTTTTCTCCCTTCATACTTTAATTATTCATTTGTTATTATCTTAACGCTTAATC TCTTTTCCCTTTTTTTCCTTTTTTTTCTTTTTTTTTTTCCTTTTTTTGGACAAATTCTATGTCGTTAACATTTATCATAT TCAGACTTAATTTTTTCCCTCACCTGTAACAGAAGACATTGAAGACAACTAATGATTTATATAGATTCATTTATCTATTT AGTATTTACCCGTAAATTTAGCTTATTTGGTGTTAATATTTAATTAATTTGTTCTCCACTCAATAATACTTAATGTTGTA AATTTATTGTTCTCTACCTTTCTAAATATCTTTGTATTATCTTATTTATTTACAAACGATGTAAATATAGATATCACTCT ATTTCCTAATATGTGATTTATTTATTAATTCGATCAACAAATTATTTCTATTATATTAAATTGTTTTGCCTATAATTGAG ATTAGTACTGTCATAAAGTTAGCATCGTCAATGTTATTATTTTAATATTGTTGATATTACTACATTATTCTTCTGTCAAT AAATCATATTTAAAATCATAAGACATTATAAATGTTGTAATAAATAATTTTTTCATATAGTTCTGTAAATATCTTTATGT ACACTATGATTTTTTACACGTAAAACACTGTTTTTAAGAATTATTTTCTTAATTTTTGGCTAAATTTTATATTTGAACGT ATGCAACAAAAAAACTTTCCATTTGAATCATTTATTGTTAATTTGAATGACTTGAGCCATATTGTTAATGAGCAATTTCT CCTTTACTTAAAGTATGAACTTAGAACAAAAAGGTGTTAAATCTTTTCAATTTTTAAAGAATATTATACAACTATCTACC CTTTTTTTTTTTTCCAAACTCCACTAAAAATATTCTGTTCACCAAGCAATGGAGCAAAATGAGAAGTTTTATCAAGTTTT AATGTATGTGTATTTTCTGTTTTTATTCTTTCTCTATTTTTTTTCTTTTGTTTTTGTTTTTACTGGAAGAAAGTTTGATT TTAGAAATGCCGATATTGTCAACCAGTTGAAATGCGATGTAAATTGATCTTCATAGATTGAGCTTCTGAAAGAAACTTAG AAGGGAAAATTTTATTCTTCTTTTCCCCTCCCTTTTGTTTTCCATTCTTTTTTTTAGAAGGTATGATTTTACTATTTTAT TATACTAATGTGTTCAATATACATGTTTTTTATTCTATTAATTTGTTTTGCCTATAATTGAGATAAGTACTGTCATAAAG TTAGCATCGTTAATGTTATTATTTTAACATTGTTGATATTACTACATTATTCTTCTATCAATAAATCATAAAAAGTCTAT ATCCCAAGCAACGTTAATGAAAAAGTCTATATCTCAAGAATAAAAATGATTATACATGAATCTAAATGGCTATTTACACT AAAAAAAGGGTAATTTCCTATTAAAATTTGCTATGCAATGACAATAAATAAAAGTCAATGACAATCTTTGAATAAAATAG GATTATATCTAGATAGCGAAATTTTTACCCATGGACAACTTATGTTGCTTTATCAAGAGCTACAACTCTAAAAGGATTGC ATATACTAATTCATGATTCAATTAATAAATATCCAAATTATATAAAAAATATTGTTTACAAAGAAATTTTACATAATATC AAATAAAGAAATAAAACACCAGATAAAAATATAAATATTATAATAAATTAAATATTAGATTCATAATCTTTTTTTATAAT TAAAATTATTTACTATTAATCTATAAAAAAACATATTGAATAAAGCTTCTTATTTTTATACACTAAAACAATTACCTTTT TTTGCCAACAGTTAGCCAAAATGACAACATTAATTCGAGTCCTAAAATCAAATGAAGTTTATGAAACTATCAGGGCTAGA ATCTGCAGAATATGGACGAATAATGATCTGAGTACTAGACGTTTGATCAGTCTTGACTGTGTTTTAGTCGACGAAGAGGT AATATTTTTTACCAAATACAATATTCTATTATTTTTCATTTAATACCAAATATTATAAATCAAATAACAATACTACTTTT TATATCTGCAGCATGAAGCAATTCAATGATCAATTTGGGCACGAGATTCAATACTATTTACCAAAAAGTCCAATTAGGCA ATATATATGATATTAGCAACTTCTTCGTCACAGAGAACAAATCAACATACAAAGTTGTGCCACATATTGCAATGCTACAG TTTGTCCGCGCAACAGTGTTCGTTCCAGTTACAGAAGAAGCACCACCTATTCCATTTCATAGATTTTACTTCATCGAATT CGATCAGCTTCAGCACAGAATTCAGTCGACTGAAATCTTAAGTGGTAAGATAAAATTACTTTTTCCAAAAAAAAAAAATT ACATCATTAATGTCTTAATTAATGTCTTTAACATTTACTATTTATTTTCCAACAGATGTCATCGGTGTTCTTACAAGAGT GCAAACAATTGAACAAACAAATATCAACAATAGACAAACATCTCGACGGACTATAATGATACAAAAGATAAGGTAAATTA ACTTTTCACAGTCATTACTGCAATCATATAAAAAGATTTATATTTAATAAAAGTATAAAACTTTTACATCATTTAAAACT CTTCATTCTAACTTTTTTATTTTATCTTTTTTTTTTCTCACAGAAACTAACAGCTTCAAGTCACATTATGGGGACATAAA GCAAATCAATTTGACGAAAATGTCATTAAATCAATAAAAGGACTAGTGGTTGCAGTTTTTGCAGCAATGTTGGTGAAACA ATATCTAGGTATTTTTTTTAACAACTTATAAAAATAATAACATATAAAATAAAGTATTTACATCTAATAAACCAAAATAT TAACCTATTTATTGCTTATGTTTAAGGCAATGCATATGTATCAAGTACTGTACCAACAATCTTCTATCTTGATCCAGACA TACCAGAAACACAAATATTAAAAACAAGGTAAGAAACAAATCCCCAAACTTTAAAAACAACAAATTTTATGCAAATTTTT TCATAATAATAATTAATTATATATATATATATATATTCTCTCAGCAACCTCAAGAAATTGAGTTCTCAACAGCATCAATA CAATTTATTGAAGAGCAAAAAACACTGAATAGGAGAACAATTGATGAACTAAAGACATTGGATCAGGAAAACAACCAAGT TAGTATCATAATATTCTATCCATTTCTTTTCCTTTAATTACATTATTTAATCTAAAAATCTTTTCACATGTATATAGGGA ACTAAATTCACAGTAAAGGCTACTATAGCTAAATTCTCAGCAAATCAAGGTTGGTATTATAACTCCTGCCCTAGATGCTA TCAACAGCTCAAACATGCGGGAACCAAATGGTGGTGCGATAGCCATGGACACATAAAGACAACACCATCTCCATGGTAAT TAAAACTATAAATATACTATAATTAAATTTTATTTACTTTGATTAGCCAAAATAAATACTTTATAACATAAATTATCTAT TATCTTATAAATTGCAGGTATAGACTAAGTGCATCTATTGAGGATCATACTGGAAACATGGATATCACCATATTTGACAG AACCGCACAAGCTTTGATAAAAAAAAAACCATGCTTAACATTAATAATTGACGAAGGATTTATAGATTTATTCACAATCC CACCAGTCATCAACCAACTAAGAGGTGAAACAAAGATCTTCCAAATATATTTTCAAAGAAAAGGACCTCAAATTGCTACA ATTGTCTCAAAAATACTTGAAGAAACTGAATTGATAACAGTACCACCACAAAATATCAGCACATGCAATATCAACTACAA GGAAAACATATTTACTCATCTTTATTAATTATATATAAACAAACATATTTCTTACTTTAAATACATATTTAAACAATATT TTACAGGCCTAGCCCCCGCTCAAGCACAACAACATCAATAGATCCACATACACTAGACCCAAAAAAATCAACCACCAGGT AATACATATTTACTATTTTACATTATTTATAAATAAAAAGCAATACTTATAATTTCAAATACATAATTTATTAACTTTTT ATTATTACAGCTCCAAAGGCAAAGGAATAGAACAGGCAAAAAAATATCCACGAACTAGGTAATATAACTACTTCTAAATC TTACTATTTCTAAATCTTACTATTTCTAATTTTTTCAATTACTAATACTAATATCTTTTAAAATTTATATTTTACAGTTG AAAAAAAACAGCGGAACCACAACAGCAAAGAAAAAGAAAGAGTTATATATATATATATATTGTAAATAACTTTATATAAT AATATGTTATATATGTATTGTATATATATATGTATATATGTATTTATTGTAAATAACTTCATATAGGAGTCCTATGTATA TATTCGTGTATAAATATACATAAATAATCTATTTCTATTGTATACAAATTACTAACTTTTTTTAACATACAAAATTATCT TCTACTGCAATGCGCGTAAACGCGCGCGTCCATGGCTAG