>DHH_12_1_Mno length=13871;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTCTACTACCAATTAATAATAATCCTCTAAAATTTTCACAACCCTATATATATGACACAGAAAATGAAATCCGAAATCG GATAGCATATTTCTCATTTGATAGTGAATCTAAAAACATAATACAATTTATAGTTAAAAATCTAATCAGAATGCTTGATA AAACAAATAAATTAGTTAAACTTTTTCGAATGATAAGGGATAGATATCAACAAGATGAGATGCCATTTATAAAACTAAGG CTTATAAGCCGAAAAAATACATATAGTAACCAATATGACCTACCCACATCGAACGATATAGCTGGTTTAATAGTTGGAGA TATTGGCGAATATGAACAAGGAAGAGACATTATTATCCAAGATAAAGCATATACTTTACAAAGAATTACCAAATTACACC CATGTTATATGGCCCTTCAATATCCTTTATTATTTCCATATGGAGAAGATGGTTACACAATAAATTTAAAATATAATATA AATAACTTAAGTAATAGATATATAAGAAAAAAAATCTTTATGCGAGAATTCTATTCCCATCAATTACAAGAACGTAGAAT TCAAGGCAATACACTTTTTTGAAGAGGCAGATTATTTCAACAATATGTAGTTGATGCATATGCTTCTGTAGAAGAGGATC GATTAGATTATATTCAGAAAAATCAAAAAAATTTGCGATCCGAGATTTATCAAGGAATTCAAGACATTATTACAAGAGGA GATACAAATGCACAAGCAATAGGAAAAAGAACTATCCTTCCTTTAAGCCATACTGGAAGCCCTAGATATATGATCCAAAA CTATCAAGATGCAATGGAAATTTGCAGACGCTATGGAAACACAGATTTATTCATAACATTTACATGTAATCTAAAATGGC CTAAAATTACTAGAGCCCTAGCAAAAATACCTAGATAAAAAGCTGAAGATAGACCATATATTATCACTAGAAATTTTTAA ATGAAATTAGATAATGTTTTATCCATCATTAAAAATGAAAAATATTTAGAATAATTACAGCAGGTTAGATTTCTTCTCCT AGACTTTTTTTAGTTTCTCGATAAGAAAAAAACACTCCTTTTTTCTAACACTACAAAAAAATTACAATAAAATATTTTTC AATCTTGCAGATTTATATGTTATTGAGTTTAAAAAACGAGGACTAGCACATTCTCATTTCCTCTTCTGGCTCCACCATGA TGACATACTACGTGAGCCATCACAAATAGACAGATTTATTTTTGCAGAAATACTTGATCCTCATAATAATCCACTAGAAT ATAACATTGTAGCTGAATTTATGATGCATGGACCATGTGGCATAGCTAAGCCAAATTCTCCATGTATGAAAAATTCAGAA TGTTCAAAAAAATTCAACAATGAAACAACCATTGACGAAAATGAATTTCTTAACTATAAACGAAGAAACACATCCTCTTA TGTCAAAAAAGAAGGTATTAAATTAGACAATAGATATGCAGTTCCCCACAATAAAAATTTATGCTTAAAATTGCATGCTC ATATCAATATAGAACTTTGTTCACAATCTATGCTTATAAAATATTTATTTAAATATTTAAAAAAAGGACCAGATAGAATA AGAGCAGTCATAGAAGATAACATACATACAAAAATAACTGGAGAAACTAGTTATCAAGAAATAAATGAAATAAAAAACTA TATTAATTGCATATACATAACACCATATGAAGCAATGTGGCGACTGTTTGAATTTTTTATACATTATAGAAATTCAGTTG TTCAAAGACTATCAATACATTTGCCAAGAATGCAAAATATAACATTCCATTCAAATCAATGTCTAAATAACATAATAAGA CAACTAGGTATTGATAAAACAACTCTCATTGAATGGATGGAAACAAACAAATATGATATTAATGCAAGAGAACTAACTTA CATAGAATTTTCAATTAGATATGTTTGGAATAGTAAATATAAATATCGGTCTCCAAGACAAATAGGACATACAATTGGAC AAACTTTTCATGTCCATCCAAGCTCTGGAGAATTATACTATCTTAAATTATTATTAAATCATCAAAAAGGCACAACAAGT TACGAAGCTCTTCGAACAATTAATGACATAACATATTCAACAAACCAAGCAACATGCTATGCATTAGGCTTATTAGGAGA CGATCGAGAATGGGATGAATCTATACTAGAAGCTACATTTTGGTCAACAGCAACTCAACTACGACAATTATTCATCATAA TTTTATTATTTTGCAATGTAAATAACCCAATAAAATTGCTTGAAAAACATTGGAAACTTATGACAAATGATATATTACGC AAAATTAAAACTTTATTTAATAACTCAAATTTTCAAGTACCTAAAACAGAATTGTACAATTTTGTACTATATGAACTAGA AAAATTATTAAATTCAAATTCATCAACCTTAACACATTTTAACTTACCTCTTACAACTAGATCATTAATGGATGTTTTAA ATAATAAACTTTTAAGAGAAAAACTTAATTATGATATATATAAATTAAAAGAAGAAAATACTAGATTAGTATATAGTTTA AATAATGAACAACAATTTATTTATCAACAAATTTTACAATCACTACATGAGGAAAAAAATCATCTCTTTTTCATCTATGG TCATGACAGAACCGGAAAAACTTATTTATGGAATGCAATAATCACAAAAATTAGATCAAATAATGAAATAATTTTAGTTG TTGCATCTTCCGGAATAGCATCACTACTACTGCCTAAGGGAAGAACTGCACATTCTAGATTTCAAATACCATTGTCAATA GATAAATTTTCCACAGGTCATATTAAAAAAGGAACTCAATTGGCAAAAGTAATTGATAAAACATCACTTATATATTATGG GATGAATCACCCATGACTAATAAATATTGTTTTGAAGCATTAGATAAAACACTTCAAGATTTAAGAAATAACTTTGAACA ACCATTTGGTGGCATGACAATTGTCTTAGGAGGTGACTTTCGACAAATTTTACCAGTTATTCTCACAGGAACAAAGGAAG ATATAATAAATGTAACTATAAATAACTCTTATTCATGGCCATATTTTAAAATTTTAAAGTTAACAGAAAATATGAGATTA AAACAATACAACCATACATAACAAGAAACAAAGAAAATTGCAACATTTTTTAAATGGATATTAAATGTTGGAGATGGTAC TGCTGAAGGAATAAAAGATTTAGAAAATGAAGGCGCTGCATTGGTAAAAATACCAGAAAAATACATACTACATTATGATT CAAATCCAATTGAAAAAATTTCAACTTCAATATATAATAATTTAAATACTTACTTTAGCAGTATTGAATACTTAAAAGAA CGAGCAATCATAACACCGAAAAATAAAACAGCTGATGAAATTAATAATTACATATTATCCTTAATTCTTGGACAAGAAAA ATCTTATTATAGTTACGACACTATTGCATCCTCATCCGAAAACATAGACGAACTTAATCTTTTATATCCTCAAGAATTTT TGCACACTCTTAACTTTAATGGAATACCACCACATGAATTAAAGCTTAAATTAGGAACGCCTATACTGTTATTACGAAAT CTAAATCAATTAATTGGATTATGTAATGGCACAAGACTTATTATTATACAATTAACAAATAAAATTATAGAAGGACAAAT CATAAAATCAAGCAATATTAATGAAAAAGTCTATATCCCAAGAATAGAAATGATTGTACATGAATCTAAATGGCCATTTA CACTAAAAATATGACAATTTCCTATTAAAATTTGCTATGCAATGACAATAAATAAAAGCCAAGGACAATCTTTGAATAAA ATAGGATTCTAGATACCGAAATTTTTAACCACAGACAACTATATGTTGCTTTATCAAGAACTACAACTCCAAAAGGATTG CATATACTAATTCATAATTCAATTAATATATATCCAAATTATATAAAAATATTGTTTACAAAGAAATTCTATATAATATC AAATAAAGAAATAAAATACAATATAAAAATACAAATATTATAATAAATTAAATATTAGATTCATAATCTTTTTTTATAAT CAAAATTGCTTACTATTCATCTATCAAAAACATATCGAATAAAGCTTCCTATTTTTATGCACTAAAACAATTACCTTTTT TGCCAACAGTTAGCCAAAATGATGACATTAATTCGAGCCCTAAAATCAAATGAAGTTTATGAAACTATCACGGCCAGAAT CTGCAGATTATGGATGAATAATGATCTGAGCACTGGACGTTTGATCAGCCTTGATTGTGTTTTAGTCAATGAAGAGGTAA TATTTTTTAACAAATATAATATTCTATTATTTTTCATTTAATACCAAATATTATAAATCTAATAACAATAATACCTTTTA TATCTGCAGCATGAAGCAATTCAAGAATCATTTCGCGCACGAGATTCAGACACTATTTATCAAAAAATTCAAATAGGCAA TATATATGATATTTACAACTTCTTCGTCACTGAGAACAAATCAACATATAAAGTTGTGCCACATATTGCAATACTACAGT TTGCCCGCACAACAGTCTTCGTTCCAGTTACAGAAGAAGCACCACCTATTCCAATTCATAGGTTTTACTTCATCGAATTC GATCAGCTTCAGCACAGAATTCAGCCGACTAAAATCCTAAGTGGTAAGATAAATTACTTTTTCTAAAAAAAATACATCAT CAATGTATTAATTAATATCTTTAACATTTACTATTTATTTTCCAACAGATGTCATCGGTGTTCTTACAAGAGTGCAAACA ATTGAACAAACAAATATCAACAATAGACAAACATCTCGACGGACCATAACGATACAAAATATAAGGTAAATTAACCTTTC ATAGTCATTACCACAATCATATAAAAAAATTTATATTTAATAAAAGTATAAAACTTTTACATCTTTTAAAACTCTTCATT CTAACTTTTTTATTTTACCTTTTTTTTCTCACAGAAACGAACAGCTTCAAGTCACATTATGGGAACATAAAGCAGGTCAA TTTGACGAAAATGTCATTAAATCAATGAAAGGACCAGTTATTGCGGTTTTTGCAGCAATGTTGGTGAAACAATATCTAGG TATTTTTTTAACAACTTATAAAAATAATAACATAGAAAATAAAATATTTACATCTAATATGCCAAAATATTAACATCTAA TACACCAAAATATTAACCAATTTATTGTTTATGTTTAAGGCAATGCGTATGTATCAAGTACTATGATTAACGTCCAAAAA TGATAGTCACAAAAAATCAATTGTAGCACAGAAGGGTGGTCGTATCCACAGACAGGTAACAAAATAAACAAGAAAAATTA GAAGAATAAGAGCGTTAGAGAAAAATAAATAACAAGTGAATTAAAGAAAAAGCATAGTTTTTGAGATTTTTGTTGCAAAT AAAATAAAAAGGAGAAAATTTGTATGAAGGAAATTCAATAGTAAAAACGGTAAGGGTTGAGAATCCCTAATCTTTCGTTC ACCAATTCAAGTTTTGATTCACAAAATAAAATAATCGAATAAATTAAATCTCTATGTTGACTCTGAAAATATTATAATTA CAAGTTATCCAAAATCGACAATATATCAATTTGACATTATTGCAGTAAAAGACAATTTGTAAAATAATTTGAATAACAAA ATAATGCGTGACAGAATTACATAAGAAAAGCGTGACTGAACTTATATAAAAATTGGCACACAATATTTTGAAAAATAAAT GAAAGATAGATGAGATTTAATTCATTCAAATATTGAACTTTACAGCACAAGGAATCAAAAGCCCGAATTAGGTCACTCAA CAAAAGTTCATCTCTAACCTCGCCAAGAGAACTCTAGCCTAGCTTGCAAAACATTCTCACAAGTTCTAGAGAGGAAATAT GAGACTGACAGCAAGATGAAAGAAAACTAAAAATTAAAAACTTACAAAAACCTTAGGCTAACCCTCTTATTTATAGTGTT CGGAGGTTGCCTCTCAAATAAGGAAACAAATAATAAAAATAGAAAATTACAAAAGAAAAGGAAACAAAATAAAATTACAC ATAAATTAGGAGAAATCATATATATGATTTGGGGAAGAAATCTGGCCAATTTGCTCTGATTTTGAAGGAGAAATTCAGAC TCAGCACTTATTAGACACATGTCGTAACGTGATTGGCAGTGAGTAGACAAAGCACCACGTGGCGCGTGCGGAATGGTTGG AGCTTGCTGGCGCGGTTAGAGTGGAGGATAGCTGGGGGACAGATGGCACCTGAGTATTTCAAACAAATTGTCAGTAAGGA GTCAAAAGATACTATCAAGATTATTTCATTTATAACTCCAGAGTCGCATGTGTGTGCTCCAAACCATAACCTTCTTACCA CTGACCATAACACATACAGTTTTGAAAAATTCACCAAGTAGAAATCCCAACTCTATTGAACATTGACCAAAAGATAGGTT AATCAACTACTAGAACATTCCATCATTCTTACCACAAATCAAATTTTGGGATTTTATTCGGGTCAAATAGAAATTTACAG AAACGAACAAAGAGCCAAAAAAATGCTAAGAAAAATAAATTACTCTTCTATTTTTTGTTTTGTTTTTTTGTTTTTTTGTT TTTTTTGGCAAGAGACAATCTGCAATAATGAAGTGAATGTAGAAAGGTGTTCTTTTGACAAACAAGTATATAGCATCAAA AGTGATTACAACCAAACTACAGGGTCTGTGAAATGTTGCTCTTACTCAGTTTTTTTTTTTTTAAAGATAAGAAATGAGGC TTTATTACATAAGATCATTCCTATCTAACCGAAAATCCACCCTCAAGCATATGCACCAAACATATCACTAACCATGTAAT GATGTTCTAACAGTGATTTTACTAGCTCAAAAGATCAATGAATGTTCAAAAGTCATTTTCTCTACTCTCTTAACTCACTA AAATTTAAGCACTTAAACTTGAGAATTTTCTCAGCTGACATGCATTAACATCCATCTTACCACAAGGTTTAGCACGTGTA AAGAGAAACTCTGGAAGTCATTTCTTAGTAACCAAGACAGCAAAAATCGACCCAAACCAATCATTTTGAATCATACTCAG ACAACTTTGCAAAAATTTTAACCTAAATATCAACATGACAAAAATCACTCTTACGTATGAACATGCTCACCACCCCCAAC TAAAATCAGATAGTGTCCTCAGTGTCAAAAATTATAGAAATCTAGGGCAAGAAAACACTTGGATGATGAGCATTCCACAT ATGAGCATAACCTGAGCTTCCTGATATAATTCTCCAAAAACACATATAAAAAAATGTAAAAAGAAGCATAGAAAATAGAA AATAAAAATATGGTACAGGAGATGTGAGCAAACTACTCAGGGCTGGTAAACGACGTCGTCGAGAATGATCTCTTCAACCT AGTTCACCCGCTCTAAGTAATTCTTCAGACGCTGACCATTTACTTTGAAGATTCTCCCATCGGTCGGGTCCTTAACCTCG ACAGCACCATTGGAAAAAATGCGTCTCACTACGAACGGGCCAGTCCACCGTGACCTCAACTTACCGGGGTGGAGATGCAA ACGGGAATCATAGAGATGAACCCGTTGATTTGGCTCGAAATTCTTCCTTAGGATCTACTTATCATGAGCCGCTTTCATTT TTACCTTGATCCTAAAATTGCGCTCCTTCAGCATGTTGATCAATCGTCGTTCTTGTAATGCATCGAGTTTAGACGACTTG ATGACTGGGAATGTGCCTTTATCTCTCAAGAACGCATGTTTTAGGCCCTCAGGTAATTGGGCTAGCTTAACTTTTGGAGC ATCCTCGGTGGATGATTTCAGTTTTTCTCCCTCTGTTGGGAGCTCTTCAAAACATGGTGGCCCAAACTTGGTTCCTTTGT CTTGTGAATTGTTGAAAATTGCAGACAAGGGAGCCAACTCAGTAGAACCGGAATTTTCAGAATCAGAATTTTGAAGGAGG TTTTCAAGATCTTCAAAGTTACTTTGCAGTTGAACCTCCTCCTCGACAAGTGTGTCGATCATGAATGTTTACTGACACTC ATCGTCATCACGTGGTTACTTTTGAATATGAAAAATATTCACCTCAAGGGTCATTTCCCGACAGATATCTTCATGAGACC ATTCCTACAATTGATAAGTGTGTTTGCTGTGGCAAGGAAAGGTCTTCCTAGAATGATGGGAATGGATTACTTCATATTCA CCACCAATTGTGTATCCAAGATAAGAAAGTCGACGGGGTAATAAAACTTGTCAACTTGCAACAGAACATCTTCCACTATT CCCCGTGGTCTCTTAATGGATCTATCGGCTAGTTGCAGAATCACAGATGTGGGCTTAATCTCTCCAAGACCCAATTGCGA GTAGACCAAATAAGGCATGAGGTTAATGCTCGATCCTAGGTCTAATAACGCTTGGCCGAATTCGTGTGTCCTAATCTGGC AGAAAATGGTGGGACAACCTGGATCCTTCTACTTCAGCAGTGTCTTCTGCTCAATCACCGCACTTACTTGTTCCGTCAAG AATGTAGTTTTCTTGACATGGTACTTTCTCTTTATGGTGCACAGATCCTTTATAACCTTGGCGTAGGCCGGCACTTGCTT GATCACATGTAGTAAGGGAAGATTGACCTTTAATTGTGTCAAGTACTCTAGGATCTCACTTTGATTTTCTGGAACTTTCC TAGCAGGTCAGAGAGCGTGGGGGAAGGGCACCTTTACTAGAATTTTTGTTGGCTCTTCTTTCTCCTGAGCTGATTCTTCA TTACTCGAACTGGTTGTACTTGTCGATGGCGTGTCAAAATTCATACCACTTCAAGTAGAGATGGCATTAACTTCCTTGAT ATTTTGACCTTCAGAGTTGGAAGTTTGAGCCATGTGTTGTCCTCTCAAATTGGACTGGGCTTGTGATGGAAATTTATCGT GCTCCTGAACGGTTAAAGCTTCTATCAGCTTTGTGATCTGACTTTTTATTTCCTTAGTCTCTTCCACCAGCTGTGTGAGT ATTGAATCAACCCATCCACAAAAGCTTTTAGGGTATCCTCTAGAGAATTCCCTTTCAGCTGCATGTTATTCTGAGGCACA AAATATGTCCTTGGTGGTTGAGATTGTTGCTCTGATCTCCATTGCCCTCCAGATGATTATGCATGTTGGTTTGGATCTCT CCAACTGAAGTTTGGGTAGTGTTTCCAGCTATCATTATAAGTGTTTGAGAAAGGTCCATAAGGCTTATTGTATGTGCCCA ATACATTGCACTACTCCTCGTATACCCCCCTCATTTCACCAAAAGTGAGACAATCTTGAGCTAGATGGCCCACTCCACCA CAAACGAAATAGGACTCATGTGCCTCTGTCCTTGCCACCATGTGGGATCCTTTACTATCTTTACTTTTGAGGGCCTCGAT TTGCTTCGTCAAAGCTTCAACTTGGGCCTTGAGGCTGTCATCTTCCCTTAATTGATAAACTCCAATGGTCGGGACCTACT AGTGCTCTCAGTAGCACTCGTTCCAGTCCAAGTATGAGCTTTCTCAGCTAACTCATTCAGGTACTCGATAGCTTCGTCAT GATCCTTTTGGAGAAAATCCCCATTGCACATCATCTCAACAAATTGGTGCTCTCGGATTGTGAGTCCATTATAGAAATAG CTTACGAGGCCCCAACTTTCATATCCATGGTGGGGACACAGATTTAACAGATCTTTAAAATGCTCCTAAGCTTGATAGAG AGTTTCATTTTTCTTTTAAGTGAAATTTGAGATCTGTCGTTTCAAATTGTTGGTCTTATGGTGTGGGAAATACTTGTTGA AGAATGTCGTCGTCATTTCTTCCCACGTACTAATAGACCTGGGCCTAAGAGAATACAACCAGCTTTTGGCCTTGTCCTTC AGAGAGAAAGGGAAAAACTTCAATCTGACAGTGTTTGCGGCCTCAGCACGGCTGTGAAAAGTGGCCACCACCTCTTCAAA CTCCCGGATGTGTACATAGGGGTTCTCGTTCTCTAACCCGTGAAAGTTTCGGAGAAGTGCAATCATGTCTGGCTTGAAAT CCGTAGGCGGTGCATACGGTGGGAACATGATGCAAGATGGGGTGGCCGTACGCGTTGGGTGCAGGTAATCTTACAACGTC CTTTGCTGTACTTCCTCGTGTTGTGCCAATGTAAATAGATTTTGACGTGCGAATTCCAACGATGAGTGTGAAGACGGAGG CGTAGATGACGAGTCGGATAGAATTTCACTAAGGGTTTCTAAGTCTGGACGTTGAGCAAATCTCCCTAGTTCGTCTCTAT ACCGATGCATTCACCCAAAGCGGTTTTTTTTTAATTTTTACTTTTTTAATTTTTTTTTCTTTTATTTTTAATCAAAACAA AAGAAAATAATTATATAGTAACGTAAATTGTAACCACCGAGAGTGCTCCCAAGAAACACTATAGCTCTTGGCTCAATGAA TAGTCTCATAGACAGAGCAACGTTCCCAAGAAAGATTGGTGGGGCGAGGCCCACTTAAGTACCAACTTTTCTAGACAAAA CTCCCTCAGATTGTGTTGTGCCAATGCAAATAGATTTTGACGTGCGAATTCCAACGATGAGTGTGAAGACGGAGGCGTAG ATGACGAGTCGGATAGAATTTCACTAAGGGTTTCTAAGTCTGGACGTTGAGCAAATCTCCCTAGTTCGTCTCTATACCGA TGCATTCACCCAAAGCGGTCTTTTTTAATTTTTTTTTCTTTTATTTTTAATCAAAACAAAAGAAAATAATTATATAGTAA CGTAAATTGTAACCACCGAGAGTGCTCCCAAGAAACACTATAGCTCTTGGCTCAATGAATAGTCTCATAGACAGAGCAAA ATAAATAACAAGTGAATTAAATAACAAGTGAATTAAAGAAAAAGAAGAGTTTTTGAGATTTTTGTTGCAAATAAAATAAA AAGGAGAAATTTTGTATGAAGAAAATTCAGTAGTAAAAACAGTAAGGGTCGAGAATCCCTAATGTTTCGTTCACCAATTC AAATTTTGATTCACAATATAAAAGAATCGAATAAATTAAATCTCTAAGTTGACTCCGAAAATATTATTATTTCAAGTTAT CCAAAATCGACAATATAACAATTTGACAATATTGTAGTAAAAGACAATTTGTAAAATAATTTGAATAACAAAACAATGTG TGGCAGAATTACATAAGAAAAACGTGACTGAACTTATATAAAAATTGGTACACAATATTTTGAAAAATAAATGAAAGATA GATGAGATTTAATTCATTCAAATATTGAACTTTATAGCATAAGGAATCAAAAGCCCGAATTAGGTCACTCAACAAAAGTT CATCTCTAACCTCACCAAGAGAACTCTAGCCTAGCTTGCAAAACATTCTCACAAGTTCTAGAGAGAAAATATGAGACTGA CAGCAAGACGACAGAAAACTAAATATTAAAAACTTACAAAAACCTTAGGCTAACCCTCTTATTTATAATGTTCAGACGTT GCCTCTCAAATAAGAAAACAAATAATAAAAATAGAAAATTACAAAAGAAAAGGAAACAAAATAAAATTACACATAAATTA GGAGAAATCATATATATGATTTGGGGAAGAAATCTGGCCAATTTGCTCTGATTTTGAAAGAGAAATTCGGACTCAGCACT CATTAGACACGTGTCGCAACGTGATTGGCAGTGAGTAGACAAAGTGCCACGTGTCGCACGCGGAATGGTTGGAGCTTGCT GGCGCGGTCAGAGTGGAGGACAGCTGGGGGACAGATGGCGCGTATTCATTGGGAAGTCCGGCTGACATCACAAGTGTGGG ACCCGCTTTGGACAGGTGGCGCGCGCGAAGAGAGCGGCAGGTTTACTGTTGTCGTGCGAGACACACGCGAAAAATGGGTT GGAACGCGCTGGAGATCGCGCACCCTGGGAGTCTCTCGTGCAGGTGACGCGCACAAGGTGGAGTGGGGAACGCGGGAGAG CTGGGGCCCACGCGAAAATAGCTTGTGGCTTCGGCTCACGCAGCTCTCTCTCTACATGGCTCGGATTGGTTGAAAATATG ACTTTCATGGCTTCTTCTTATGTAGCTTTTTACACTGCTTTCATCTATAAATAATTAAGCAAAAACTAGACAAATTCTAA TTAAAAATATTATGAATAAAAATAATTGAATTGTTTAATTAAAGCTTAAATATTTTAATATTATATAAATCAAAAGCAAT ATTTAGAGTGCATTTTCATGCACTTATCATACTGCAGCAACAATCTTCTATCTTGATCCAGACATACCGGAAACACAAAC ATTAAAAATAAGGTAAGAAAAAAATCCCCAAACTTTAAAAACAACAAACTTTATGCAAATTTATTCATAATAATTAATTT TATATACATATAGATTCTCTCAGCAACCTCAAGAAATTGACTTCTCAACAGCATCAGCAGTACCAACACAATCTATTGAA GAGGAAAAAATACTAAATAGGAGAACAATTGATGAACTAAAGACATTGGATCAGGAAAACAACCAGGTGAGTATCAAAAT ATTCCATGTATTTCTTTTCCTTTAATTACATTATTTAAGCTAAAAATCTTTCCACATGTATATAAGGCACTAAATTCACA GTAAAGGCCATTATAACTAAATTCTCAGTAAATTAATGCTGGTACTACAACTCTTGCCCTAGATGTTATCGACAGCTAAA ACAGGCGGGAACTAATTGGTGGTGTGATAGCCATAGACACATAAAGACAACACCATCTCCATGGTAATTAAAACTATAAA TATACTCTAATTAAAATTTATTTACTTTGATTAGCAAAAATAAATACTTTATAACCTAAATTATCTATTATCTTATAAAT TACAGGTATAGGCTAAGCGCATATATTAAGGATCATACTGGAAACACGGATATTACTATATTTTGGCATAGCAGCACAAG CCTTGATAAAAAAAACAATGCTCAACATTAACAATTAATGAAGGATTTACCGACCCATTCACAATCCCACCAATCATCAA CCAACTAAGAGGTGAAACAAAGATCTTCCAAATATATTTTCAAAGAAAAGGACCTCAAATTACTACAATTGTCTCAAAAA TATTTGAAGAAACTGAATTGATAACAACACCACCACAAATATCAACGCTTGCAACATCAACTACAAGGTAAAGCATATTT ACTCATCTTTATTAATTATATATAAAAAAACATATTTCTTACTTTAAATACATATTTAAACAATATTTTACAGGCTTAGC CCCCGCTCAAGAACAACAACATCAATAGATTCGCATACACCAGACCCAAAAAAATCAGCCACCAGGTAATACATATTTAC TATTTTATATTATTTATAAATAAAAAATAATACTTATAATTTTAAATACATACCTTATTAACCTTTTATTATTACAGTTC CAAGTCTAAAGAAATAGAACAGTCAAGAAAACGTCCATGAACTAGGTAACGTAACTACTTCTAAATCTTACTATTTCCAA TTATTAATACTAATATCTTTTAAAATTTATATTTTACAGTTGAAAAAAAAATAGAGAGACCACAACAGCAAAGAAGAAGA AAGAGTTATATATATATATATATATATTGTAAATAACTTTATATGACAATATGTTATATATTTATATATATATTGTAAAT AACCTCATGTCAAAATATATTTTTTATATATATTTATTGAAAATAACTTCATATAACAATGTCCTGTGTATATATTCATG TATAAATATACATAAATAATCTACTTCTATTGTATACAAATTATTAACTTTTTCTAAGATACAAAATTACCTCCTACTAC AATGCGCATAAACGCGCGCGTCCATAACTAG