>DHH_11_1_Mno length=14402;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTATATATATATATAATTAATTATTATCATGAAAAAATTTACATAAAGTTTATTGTTTTTAAAGTTTGGGGATTTGTTT CTTACCTTGTTTTTAACGTTTGTGTTTCTGGTATGTCTGGATCAAGATAGAAGATTGTTGCTGTAATACTTGATACATAT GCATTGCCTTAAACATAAGCAATAAATTGGTTAATATTTTGGTGTATTAAATGTAAATATTTTATTCTATATGTTATTAT TTTTATAGGTTGTTAAAAAAATACCTAGATATTATTTCACCAACATTGCTGCAAAAACTGCAACGACTGGTCCTTTCATT GATTTAATGACATTTTTGTCAAATTGATCGGCTTTATGTCCCCATAATGTGACTTAAAGCTGTTCGTTTCTGTGAGAAAA AAAAGTGTGGAATAACTTATCGGTGCGAAAATAACACCTATTTTCTACTCGCAAGTGCACGAGGTCGACAAGTAATAAAG TAGTGAGTGAGTGTCATGTCCCACGAGGATTGTGTTCCTAAAGTCTAGCTAAGTATCACAACTAGAATAACCCAGTTTTA TCTAGACAAGTCCAATCATGAGAATGAGATCAATCAAAACAAAAATAAAATGCTAAACTAATTAGACGAGCAAATTAAAC AATGGAAGAAACTTTTGGGATCGAAGGGGGCTCTAATGATAAGGTAGCTAGGGTCCTTGATTTCACCTTGCCTAATTATT CTAATCCTTTTTAATGCTATTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTAATTAAGTTAATTGTGCATTCATTAAGCTCTAATTCATTTGTGAT TACCTAGCTCATATTCATCTCTCGATTCCAATACTCACTAGGCTGTGTTCAACAAATCCCAACATGTGCAAGTGACTCTC TCAAGCCTAAATCCACATATCTAAATCTTCTAATCAATCTTTCAATTTATTAAAGCATTAAGCAAAGAAGAACACAAATG TTTGGGCATGAAAAAATCAAATAGCATCAAATATTCATAGCATAATCGTAGCAAGGTTACATCAAATCCCCAAGCATAAA AATCTAGCAACCCATCAATGTAAACTCAAATATATTCAAGATTAAACAAATCTGAAAATACATGATAAATCCGTAAAAAT AGAGAAAATACCTAGTCTAAGAACAAAAGAAAGGGAGAGGAAGAAAAATAAAACTCAGTGTAGTCCAGCTTCCAATCTCC AAGAGCTTCCTCTGATTCCCCAGAAAAACTAGGATTTTTCTCCTCTCTATCTGTTGCCCCCAAAAACTAGGGTTTTTCCT TTGTCTATGTTGTCTCAAAAACTCTCCTTTGCTCTCTATGTGTGTTCCCCTTTTTGCCCAACCAAATTCTATATGCCCCG AAAATGGCCTCAGCTCGCCAGAGCCCTCAGAGCGCGCGGCCGCGTGCTTGGGGGCCAGGGTGCGGGCGCGCACTGGTTCC CTGATGTGGGCGCGCGCTGGTTCCTTGATGTGGGCGCGCAGGCGTGCACTGGAGTCCCTGATGTGGGCGCGCGGGCACGC GCTGGAGTCGGGCTCCTTTTGACGTTTTTCTTCCAAGTGATCCAATTCTTCTTTGTTTACCTGAATCACTCACAAACATA TTAAAACAACCTAAAAACTTGAAGATATTGCAAATTATTCAATTTTAGGACATTAAATAAGTGAGTTAAAACTCACTCAT CAATAACAAATTTAGAATGAAGAGTTTTAAATGATATAAAAGTTTTATGCTTTTATTAAATATAAATCTTTTTATATGAT TGTGGTAATGACTATGAAAAATGAGTTTACCTTACATTCTGTATCATTATGGTTCGTCGAGATGTTTGTCTATCGTTGAT ATTTGTTTGTTCAATTGTTTGCACTCTTGTGAGAACACCGATGACATATGTTAGAAAATAAATTGTAAATGTTAGAGGCA TTAATTAATACATTGATGATGTTTTTTTTTTTTTGGAAAAAGTAATTTATCTTACCGGTTAGGATTTCAGTCGACTGAAT TCTGTGTTGAAGCTGATCGAATTCGATGAAGTAAAATCTATGGAATGGAATAGGCGGCGCCTATTCTGTAACTGGAATGA AGACTGTTGCGCGGGTAAATTGTAGCATCGCAATATGTGGCACAACTTTGTATGTTGATTTGTTCTCAGTGACGAAGAAG TTGTTAATATCATATATGTTGCCTAATTGAATTTTTTCATAAATAGTATCTGAATCTCGTGCTCGAATTGATCCTTAAAT TGCTTCATGCTGCAGATATAAACGGTGGTGTTGTTATTAGATTTATAATATTTGGTATTAAATGAAAAGTAATAAAGTAT TATATTGGTTAAAAGATATTACCTCTTCGTCAACTAAAACACAATCAAGGCTGATCAAACGTCCAATGCTTAGATCATTG TTCATCCATAATCTACAGATTCTAACCCTGATAGTTTCATAAACTTCATTTGGTTTTAGCGCTCGAATTAGTGTCGTCAT TTTGGCTAACTGTTGGCGGAAAAGTGGTAATTGTTTTAGTGCATAAAAACAAGAACCTTTATTTGATATGTTTTTGATAG ATGAATAGTAAGCAATTTTGATTATAAAGAAAGATTATGAATCTAATACTTAATTTATTGTAATATTTGTATTTTTATAT GGTATTTTATTTCTTTATTTGATATTATGTAGAATTTCTTTGTAAACGATATTTTTTATGTAATTTGGATATCTATTAAT TGAATTATGAATTAGTATATGCAATCCTTTTAGAGTTGTAGCTCTTGATAAAGTGACATATAATTGTCCGTGAGTAAAAA TTTCGCTATCCAGATATAATCCTATTTTATTTAAAGATTGCCCTTGGCTTTTATTTATTGTCATTGCATAGCAAATTTTA ATAGGAAATTGTCATCTTTTTAGTGTAAATGACCATTTAGATTCATGTACAATCATTTATATTCTTGGAATATAGACTTT TTCAACATTGCTTGAGTTTATGATTTGTCCTTCTATAATTTTATTTGTTAATTGTGTAATAATGAGTCTTATTCCATTAC ATAATCCAATTGATTGATTTAGATTTCATAATAACATTATAGGTGTTCCTAATTTAAGTTTTAATTCATGTGGTGGTATT CCATTAAAGTTAAGAGTGTGCAAAAATTCTTGAGGATATAAAAGATTAAGTTCGTCTATGTTTTCGGATGAGGATGCAAT AGTGTCGTAACTATAATAAGATTTTTCTTGTCCAGGAATTAAGGATAATATGTAATTATTAATTTCATCAGCTGTTTTAT TTTTTGGTGTTATGATTGCTCGTTCTTTTAAGTATTCAATATTGCTAAAGTAAGTATTTAAGTTATTATATATTAAAGTT GAAATTTTTTCTATTGGATTTAAATGATAATGTAGTATGTGTTTTTCTGGTATTTTTATTCCTTCAGCAGTACCATCACC AAAATTTAATATCCATTTCGAAAATGTTGCAATTTCCTTTTTTTTCTTGTTCTGTATGATTGAATTGTTTTAATCTCATG TTTTCTGTTAACTTTAAAATTTTGAAATGTGGCCATAAATAAGAGTTATTTATAGTTGCATGTATTATATCTTCCTTTGT TCCTGTGGGAATAACTGGTAAAATTTGTCGGAAGTCACCTCCTAAGACAATTGTCATGCCACCAAATGGTTGTTCAAAGT TATTTCTTAAATCTTGAAGTGTTTTATCTAATGCTTCAAAACAATATTTATTAGTCATAGGTGCTTCATCCCATAATATA AGTGTTGTTTTATCAATTAGTTTTGCCAAGTGAGTTCCTTTTTTGATATGACAGGTGGAAAATTTATCTATTGACAATGG TATTCAAAATCTAGCATGTGCAGTTCTTCCCTTAGGCAGTAGTAGCGATGCTATTCCGGAAGATGCAACAGCTAACATTA TTTCATTATTTGATCTAACTTTTGTAATTATTGCATTTCACAAATATGTTTTTCCATTTCCGCCATGACCATAGATGAAA AAGAGATTATTTTTTTCCTCATGTAGTGATTGTAAAATTTGTTCATAAATTATTTGTTGTTCATTATTTAAACTATTTAC TAATCTAGTATTTTCTTCTTTAAATTTATATATATCGTAATTAAGTTCTTCTCTTAAAAGCTTATTATTTAAATCATCCA TTAATGATCTAGTTGGAAGAGGTAAGTTAAAATGTGTTAAGGTTGATGAATTTAAATTTAATAATTTTTCTAGTTCATAT AGTACAAAGTTGTATAATTCTGTTTCAGGTACTTGAAATTTTGAGTTATTAAATAAAGTTTTAATTTTGTGTAATATATC ATCTGTCATAAGTTTCCAATGTTTTTCAAGCAATTCTATTGGGTTATTTACGTTGCAAAATAATAAAATTATGATAAATA ATTGTCGTAGTTGAGTTGCTGTCGACCAAAACAAAGCCTCTACTATAGATTCATCCCATTCTCGATCGTCTCCTAATAAG CCTAGTGCATAACATGTTGCTTGGTTTGTTTGATATGTTATATTATTAATTGTTCGAAGAGCCTCGTAACTTGTTGCACC TTTTTGATGATTTAATAGTAATTTAAGATAGTATAATTCTCCAGAGCTTGGATGGACGTGAAAAGTTTGTCCAATTGTAT GTCCCATTTGTCTTGGAGATCAATATTTATATTTACTATTCCAAACGTATTTAGTTGGATATTCTATGTAAGTTAGTTGT CTTGCATTATAATCATGTTTGTTTGTTTTCATCCATTCAGTACGAGTTGTTTTATCAACACCTGGTTGTCTTATTATGTT ATTGAGATGCTGATTTGAATGGAATGTTATATTTTACATTCTTGGTAAATGTATTGATAATCTTTGTACTGCTAGATTTC TATGATGTATTGAAAATTCAAACAGTCGCCACATTGCTTCATATGGTGTTATGTATCTACAATTAATATAATTTTTTATT TCATCTATTTCTTGATAGCTGGTTTCTCCAGTTGTTTCCATATGTATATTATCTTCTATGACTGCTCTTATTCTATCTGA CCCTTTTGTTAAATACTTAAATAAATATTTTATAAGCATAGATTGTGAACAAATTTCTACATTGATATGAGCATGAAATT TTAAGCATAAAGTTTAATTGTAGGGAACTACATATCTATTGTCTAATTTAATACCTTCTTTTTCTACATAGGAGGATGTG TTTCTTCGTTTATAGTTAACAAATCCATTTTCGTCAATTGTTGTTTCATTGTTGAATTTTTTAGAAAATTTTTTTGAACA TTCTAAATTTTTCATACATGGAGAACTTGGCTTAGCTGTGCCACATGGTCCATGCATCATAAGTTCCTCTATAATGTTAT ATTCTAGTGGATTATTATGGGGATCAGGTATTTCTACAGAAATAAATTTGTCTATTTGTGATGGCTCACGTAGTTTGTCA TCATGATGGAGCCAAAAGAGGAAATGTGAATGTGGTAGTCCTCGTTTTTGAAACTCAACAACATATAAATCTGCAAGATT GAAAAATATTTTATTGTAATTTTTTTGTAATGGTAGAAAAAAGGAGTGTTTTTTTTTTCTTATCAAGAAACTAAAAAAAG TCAAGGAAAAGGAACCTAACCTGCTATAATTACTCCAAATATTTTTTTCATTTTTAATGGTGGATAAAAAATTAACTAAT TTCATTTTAAAAATTCTAGTGATAATATCTGGTCTATCTTCAGGTTTTTGTCTAGGTATTCTTGCTAGGGCTCTAGTAAT TTTAGGCCATTTTGGATTACATGTTAATGTTATAAATAAATCTGGGTTTCCATAGTGTCTGCAAATTGCCATTGCATCTT GATAGTTTTGGATCATATATCTAGGACTTCCAGTATGGCCTGAAGGAAGGATAATTCTTTTTCCTATTGATTGTGCATTT GTATCTCCTCTTGTGATCGCTTCTTCAATTCCTTGATAAATCTCGGATCGCAAATTTTTTTAGTTTTTTCGAATATAATC TAATCGATCTTCTTCTACAGAAGTATACGCATCAACTACATATTGTTGAAATAATCTACCTCCTCGAAAAAGTGTATTGC CTTCAATTCTACGTTCTTGTAGTTGATGGCAATAGAATTCTCGCATAGAGATTCTTTTTCTTATATATTTATTACTTAAG TTATTTATATTATATTTTAAATTTGTTGTGTAACCATCTTCTCCATATGGAAATAATAAAGGATATTGAAGGGCCATATA ACATGGGTGTAATTTTGTAATTTTTTGTAAAGTATCTGTTCTATCTTGGATAATAATGTCTTTTCCTTGTTCATATTCAC CAATATCTCCAACTATTAAACCAGCTATGTCATTTGATGTGGGTAGGTCATATTAGTTACTACCTGTATTTCTTCGGCTT ATAAGTTTTAGTTTCATAGATGGTATCTCATCTTCTTGATATCTGTCCCTTATCGTTCAAAAAATATTAACTAATTTATT TGTTTTATCAAACATTCTGATTAGGTTTTCAACTATAAATTATATAATGTTTTTGGATTCACTATTAAATGAGAGTGATG CCATCCAATTTTGGACTTCATTTTTGTGTCATATATATAGAGTTGTGTAAATTTTGGAGGATTATTATTAATTGGTAGTA GATACCCCATAAGATGATGTACTTGTCCACTTATTTTAAAAATATTTGGGCCATTTGGGTTCTGTGTACTTGTGTCTATA TTGGCTCCAAATGATGTAAATACGAACATAGAGTTATATGTTCGAATATTTCTTCAGAAATGTGTGCTAATTAATCCGAC ATGGTAATCAAGAAGTGTATCAAGTGTTTGAGGAGTCTTTTTAATTAAGGGTAAAGTTATTTTTCCATCTTTGCAGCAAA GATTATACTTAGGAATAGTACTGCCACTAATTCGTTCGTTTAGCCAAAAGAGAGCGCCGCAATGTTGACAAATGTAGGAA CAGTCTCCGAGATCGATATGGACATTAGCAATGCCTATAAAAGATGTTGACAATACATAAAAAAATTAGTATTGTCATTG TATGAAATGTTTTTTTAATTTTTGAGAAAAAATAATTGGCATGAATGAGAGAATTACGTTCTCTATCACAACTTCCCGAT GATAATGGCATGAATGATTCAAGAATCTCCTCCTGAGACTGTGTAAGTTGTAGTGTTGTATTAAGGTTGGATTGAGAAGC CCTTGCCCGCAAAGGTGTAGTAATTTGATTTATTTCATTTGAGCGGTGCTCGTTTACGTTGGTAAAATTTTGATTCATCT GAGAGATGATACGGCGCATACGTTTGTTTGATTTTAGAATTTTTTCTTGAATTTTTCTCTTCTCCATTTGTTTCTAGGAT ACAAAATTACTTTTGTTAGAAAAGAATGAAATATGTATTTATGTAAATAATTTGCATAATTAGTTTTATTATAATAAAAT CAGTTGTGAGAAATTAAGCAGTTAATTTTTTTATCACAATATTTATGATGTCTTATAATTTTAATTATGATTTATTGAAA GGAAAATAATGTAGTGATATCAACAATATTAAAATGATTCCATTGACAATGCTAACTTTATGACTACTAATTTCAATTAT GGGGAAAGTAAATTAATACAGCAAAAGTAATTTGTTGATGGAATTGATAAATAAATTAGATATAAAGAAATAAATTCATA TTTATATTTGTATCTTCTCCGTATTAATGAGACAGTATAAACATATCTAGAAAGATAGAAAATAACAAGCTTACAACATT GAGTATTATTTAATGGACAACAAATCAACCAAATATTGATACCAAATAAGTTAAATTTATGGATAAATAATAAATACATA AATGAATCTATATGAGTGATTGATTGTCTTCAGTTTCTTCTGTTACAGGTGAGGGAAAAAGTTAAGTTATGCTGTAACAA ATGCTAATGGCATAGGATTTGGAGGGGAAAATAAAAGAATAAGAAAATGCTAAGATAATAACAAATGAGTAATCAAATTA TGAACAGGAAGAAACGATTATGGATAAATATGGGAAAGTTTTAGTATATTGTAATTGTGGCTTAGATATATGATATATTT ACAAAGATAGAGAATAATAAGTTTACAACATCGAATATTATTCCATGGACAACAAATTAATCAAATATTAATGCCAAATA AGCTAAATTTATGGGTAAACAATAAATAAATAAATGAATCTATATGAGTAATTTATTGTCTTCAGTTTCTTCTGTTGCAG GTGAGGAAAGAAAGTTAAGTCATGCTATAACAAATGCTAATGACATAGGATTTGGGAAAGGAAAAAAGATTAAGAAACTA CTAAGATAATAATAAATGAGTAATCAAGTTATGAACAGAAAAAAACGGTTATAGATAAATATGGGAAAATCTTGGTATAT TGTAATTGTGGCTCAGATATATAATAGTAATTTGAATAATATGTAGTGAGTAAGTTGGTTATAATCAAATGTAAAAGAAG GAAAAAGTGGAAAGACAACATAGTGTGCAATGTAATAAGTAAAGGTATAGGATGATATAAAAGATTGAAGATGCTTGAGT TTAGGACGAAATATAAGATGTTTAAAAGGGATGCGATCAGGAGTAGAAAGCAAGGAAAGTAGTTGAAGCCAAGTGTCAAG TTATTCAAAATATTAATTGATTAAATAATAACAGGGGGAAAAAAGAATAAGTAAAATTTAAGGCTGTTCAAAAATTACAA AGTAGATGAAAACGATTAAAGTGATGGAACGTCATAAAAGCAAAAGGAAATAAGGGAATATAATATTAGGGAAGAGTAGG CATTGTCAGAATATAAGAAAGTAAAAAAACTTGAAAACGTATATAGAGCAAAGGGGAAGGAAATGCTAGGGAAAAAAGAG TAGGGAAAAAAAAGGCAATAAATTGTATAAGTAAAACTGAGGAAATGAGATAGATTAAAAAGAAATGAAAAAGGAATATA TTGAGATGATAAGAAGAGAAGGAACTGGAATAAGTAAAAAAAAATATAAAATGATATGAATAATTTTTAGGTAAATTATA TAATATTAAAAATATAAAAAATAATTGTAATCATCATTGTCACATAAAAGGGGAGTGGAGAAGGGTATAGAAAAAGGAAT ATAGCAGTGAAATTAACCTATGAGATTGAAACTAACGAAGTAAGTTCTACAATGGAGTCAAAAAGAGATAAAATAATAGT GTCAATTTATGAGAAATGGACAAACTAAGTTGTTATATTGGGGAAAGGAGCAAAAAATAAAAAGGAACACTAAAGAGGTT GTATAGAAGAAGAAAAAGAACATAAAACCAGTAGTTCGTTATCGATAGTCACATAAAATTTCTTACATTTATAGGGTCAC GCCTAAATATTGAACAATAAATGTCAGTGATTAATAGATTTCAAATTCATCTCTAATTAAGTCAGTTATTATTTCATTTT TATTTTTATGTTCTATCATATGACTAAATACAATGTTATAATTATTATCTCTTTGAAATTTAAATATGGCTGATACTTTT TTCTCATACAATAGGTAACTATATAGAATTAGAAAATATTTTCTCAAATATCAACACGGTCTTCAATTTATTTGTCTTGT TCAAGTAGTGTTCCAAACAATTTGTAGTGATAGTCGAATGGGAAGGGACTAATAACCTAGGTTCAACCTATCAGATTAGC ATTCTAAAGCCATCATACTCTACATAACTAATTAGCATTAGAAACAACTTTAATCCAAGCAATCAATGCATCTAGTGTAA GCAACCAAAATTAGAAAGTGATAGGGGGAGACTATTAACAATACCTCAAACGCTATAAATTCTCTCTGAAACACCAAATA CGAACCAACTGGGTGTGAACAGGAGCCAATGATATAGAGGTGATAGGATGGTAGAATAAACAGGACCAAACCTGGAAAAA GAGAATTAACCAGGTAAATGAATAAACAAATAGAGGAAAAAGAGCCTAAAAAAGTAGTGGATGCAGGCATAACAATGTTT TTAGATAGTAATTACAACTTAGGTATAGTATGTTCCCAGCAATGTATGATAAATAGATTCTAGCAACTTGCTAAGGACAA ATGCACAAAGAGGCAGAATATCATATTCACCGCACAGATTGTAGGACACATGCGACACAAAATAAAAAAATGGACTAATA CATAAAGTTGTCCAAAAACTACCGGGTGAATTGAAAGAGAGGTGGAAAACAACAACACCAATAGAGCAATAAGGACTGTA ATTTATGCTAAGAAAAAGTAAAGGAAACGGTTGAGAGAAGAAGACTAAGGAGAAAGAAACACAGTAATAAGAAGATAATG AAGAACGTTATGAGAGGACAAAAATAAGACAACAGAATATTTGTCTCTTTTCCCATTAGTTTTTTTTTTTTTGTATGAAA CAGTAAAAACAGGATGGCAAAACTAAAATTTAGCTTGAAAGAAAAAGGTAAAGACACCTATAAAGAGTTTTTCAATAAAA CAGTCAATATGGAAAAGGCAAATGCCCTGGAATAAGTAAAGGTAACAATACATAAAGGAGTTAAAAATCTAGACAAAAAA TAAAAGGCTACCGGGTGAATTGAAAGAGAGGGAAAAAAGAACAACACCAACAACAGAATAAGGACTGTAAATAAGTAAAG GAAACAGGTAAAAGAAGAAGACTAAGGACAAAGAGACAGAGTAATAAAAATGATGAAGAATGTTATAAGAGGACAAAAAT GAGACAACACAATATTTGTCTTTTTGTCCAATAATTTTTTTTTCCCTATGAAACAGTAAAAACAGGATGGTGGAGCTAAA ATTTAGCGTGAAATAAAAAAGTGAAGATACCTATAAAGAGGTTTTCAATAAAATAGTCAATATGGAGAGGCAAAGGCCCT GGAATAAGTAGAGGTGATAACACACAAAGGAGTAAAAAATCTACACAAAAAATAACAGATAAAACCAGGATCCAAACAAA GACGACACATTCACAGCAATCTTTGGACAAATTACGTAAAAGTCAACACATGAAGACAAACTACGATGATCATCGCCACA CACAAAAAGTTACTAAAGCTGGGATAAGTAAAAATAGGAATATATATATATATATATATATATGAGGACATGCACACACA TGTAAGTAAGAAATAAGTAAGGAAGTCACAGAGGAAAACCAAGACAGATACACTAAGCAAATACAGAGGAAAAAAAAGGA CAGGTAATAAAAGACAAACCGCAGACATTAATAGGCCCACAACAAACCAGTGCATTCAATATCAACAGCATAAATGAGCA AGCTATGGATAAGAAGTGTCAGGAGTACCTCGAACGCTACAAATACTGTGTTCAGTCTGAAATATCAGTCAACCAAACGT GACCAAAAGATAGTAAATGATTGAAAGTGAAATAAGAAAGCAAAAACAGGGGATGGAAGGGAAAATAATAGGAGAATGCA TGATAAATTCATGTGCAGACACATTCTTAAATAGACAGAGAGAACTAATGAGCAGCCCATAACAAAATCCCACGTAAGGG CCCAAAATCGGTGAGGTAAAAACCAGAAGTTTTCAGATTAAATAATAAAAAGCAATACATTAATGGCAATACAGAAAAGA AGTAAGACACATATTTAAAATATAAATATAACAATTACCCACATTTGTTGGCTAAATTCTTTACACGTTTCAGAAAATAA AAATAAAAATCAAAGATTCATTAAATACCTCTGCAGTAGAGTGAGCATAAGTACAGAAAAGAGGTAAGACACGTATTTAA AATATAAATTTAACAATTACCCACATTGGCTAAATTCTTTACACGTTCCAGAAAATAAAAAAAAATCAAGGATTCATTAA ATACCTCTACAGCAAAGTGAGCATAAGTCATCAACGTAGAAAGACAAGTCAGCACCATAGAGTCCACAGATCATCACCTC AATAAATACATGCAAACAAAATCAAGATTAACCGGAAACAATATAGAACAACGCATATAAGAAGTCTTTTGTGAACAAAA AGACCAATCAAGGAAAATAATAAACAGTTGTAAAGGAATTTCTCACGTACCGTACATGCCAGCCAATTAGAAATTGGTTT CAGGCTTAAGAAACACAAAACAAATCCAAACAGATGAAGCACAAAAACAAATAGCAAAGAGAATAATGTAACTAAACAAT AAAAGCAGGCAAAAAAAACAAAGAAAGAAAGAAGGGGCCGAACATCTAGTCACTCAAAAACAGATAAAAACCCAAACCAA AACCATGAATGAAGCGAGCCTAGAAGCAGTCCAGGAAAACCAAAGAGACCTGCGCCAAAACCCAAATCAAACTTTAATGA GCATTGAAAAAAATCATAAAAAATGAGACAAAAAACCAAGCCACAAATAAAAATGGCAGAACAATCTCGAAAAACACAAA ACAAATCCAAATAGGTGGAGCACAAAAGCAAATAATGAAGAGAATAATGTAAGTAAACATTAAAACCAGGGGAAAAAAGA AGAAAAAATAGACCAAGCATCTAGTCACTCAAGAATAAAGAAAAACCCAAACCAAAACCACGAATGAAGCAAGCCTAGAA GCAATCTAGGAGAACCGAAGAGGCCTGCACCAAAATCCAAATCCAACTTCAGTGAGCATTAAAAAAAATCAGAACAAATG AGGCACAAAAGCAAGCCACAAATGAAAATGGCAGAACAATGTCAAAGGAAGAAGGGATAAAATCCCAAAATTTCCCCCAA AATCAAAGGAAAAGGACAAGGACAAAAAATGACTGAACATGCAATGAGCCAAAGTCGGACAAAAATCGAACCCAAAACCA TAGATCAAGCAAGCACAAAGGCAACAGAGCAAAACCCAACAGGATCGCGCCAACACCCTCATGAATCAAAGACCGATCCA GCAAAATCACAGTAGAAAATTGCACCAAAACCGCAAAGAAAAATGCCCAAACAGGACAGAGAAAGCAATGATAAAATCCC AAGGCTTCCCCCAAAATCAGAAGAGAAAGGCAAAGGAAATCAAACCGCTAGCCAAAGAGGGCAAGGGAAAGAAGATCGAA GGGGCACAGAAGCAACTGAGGAAAACCCAACATGCCCGGGCCAACACCCGCATGAATCAAACACCAATCCAGCAAAATCA CAGTAAAAAATCCCACCAAAACCGCAATAAAAAATGCCCAAGCAGGACGGAGAAGGCAACAATAAAATCCCAAAGCTTCG CCCACAAACCACCAGTGAAAGAGGGCAAGGGAAAGAAGATCAAAGGGGCAAAAGATGATCGAAGGAGGGATCTACGGCAG CCACCGAAAGAGGGCAAGAGAGAGACGATCGAGAGAGGAAAGAACACTTAGTGCTACACCAACCGGGAAAAGACCAAACA CACTAGGGCAAGAGACCGAAGAAGGGCAAGAGAGAGACGATCGAGAGAGGAAAGAACACTTAGGGCTACACCAACCGGGA AAAGACCAAACACACCAGCGCAAGAGACCGAAGAGTGAAAGAGGAGCAGGGGCAAAACCGCGAAAGCAACGCGCAAGTGG CAAATAGACAAAACAACCCCTAGTAGAGTGAAGGAAAATGAAAGAGAAAAGGGCAAAATCGTCACTTCACTGTAGAAGGA ACAGCAAAATGGGTCTGCGTGAACAATACCCCCAAGCTCTCCTTTAGATTATTTATAAAATGTCAACTAAAAAAACTCAA TACTACCATGCAAGAACAATAATGGATTTGAACCATCTCCGCTATTACAAAATAATATGTTAAGAATAATGCTAACGCCA CTAACTTCTCATAAAGATCATGTGACGAGCTTTTGCTCCCAAATGAGTAAATAAAATATTTTAAACAATTGTTCGTACAC GAACTCCCAATTACAAATCTTGATTCTCACCCTACTCTTAGCCAAAGCCATCTATGTAACTGAATGCCAATCTCCTTCGG AGCAGGTTTTTTTTTTTTTTTTTCACAAGGAGAGATTAAACCAGCAACCTCCCCCTAAAGGCCCCACCCCGCCCCCGGTG CCACTAGACCCAACAGTAAGGGAACAGTAACAGCTATTTGTATTATTCAATGAACAATCTTGTCTATTGATGGTTTCAAT ACAAGACATGACCAATATTTTGAATACCCAAATTCAACATTGGATATGCTAACACGTGGTATAGAAGCTAACTAGTTGAG AAACATTGCATTGGATGCATCATGCATGTCAACTTCTCATCACAGCAGACAACCTTTGAAACCTTTTCTCAAAGCATTTG CATCCAAATTCCTTCCTATGAACACAAGCTTGTTTACCCTCTTTTCATCCGGTCCCCACGTACTGCCCGGGCAACCGTCT AG