>DHH_10_1_Mno length=14594;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTAAATATACTATATATAAAAATTTATAAAGATTATGTATTTATCTTGCATATTATTGGTATAAAAATTCAAAGTTTAC TTAACTTATATGATATTATGAGTTTAAAACCTATCCAATTATAAATAAAATTGTATAATTGAACAAATTGGTATTTTAAT GACGAGATCATTATGATATAACTATAATTTGTCAGCAATATTTATCCTTCATATAACGTGGCCATTAGTGTAATAATCGT GCATTAGTTTAAAGTTTTCATTTATGCAAAGATCGAAGAAAAGTGTGTAGTTTTAAACTGGAGTGTAATTACCTCTATAT TTTTTTTATTTTTTTTTGCATGCACCTTCACACCTGGTTCTAGGTTCTAATATAGCTACGTGAAAACAAAAGGTGAAAGT TTAGAGTGCAACAAAAAATGCCCGAACTCGATTGGATTAGATAATATACTAGTTATTAGATTAGATTGGATTGGATAAGA TAATATACTAATTATTAGATTTGATTGGATTGGCTTAGATGAAATTCTTAAAAATCAAGCGTTGATTAGATTGGATGTTA TATGGCTAAAAAATAGGGGTTAACAAAAAACCTGAGGAACCCGATTAACCCACCCAACCCAATCAAACTCATTTTTAACC CGAACTCGACCAATTCGATCAAGAGTTCAACCCAACCCGACTTTTAATTGGGTAGGTTTGGGTTGAGTTTTTTCTTAACC CAAATTAACCCGAACCCACCCAATTTATTTATCTATATAAATAAATATTTTCCTACCTCATAATATATAATTTTTTCTCA TATTTTACATTATTTACTTAACAATCTATTATGTTTTACGTTGTATAAGTTTTTATTATTGTTTCTTTATTGGTTTACAA CTTATATATTTGAATTTATTTTGTATATATTTTATTTTTATATTGGTTTGTAGCTTATGTGATAATTTTAGAGCTTTATA AGGCTAATATTATGATGAAAGATAGCTTTCTTTTTATACATTTCTTATTTTGAGTTGAATGATTAGCTTTATTTATTTAT TTTTATTTTTTATTTCTTTATTATGTTCAACTCGATCAACCCACCCAAATTCTAATTGGGTGGGATGATTTTTAAACTTT GGGTTGATTTAGTGGGTTAAATTTGATATCAACCCATCCAAACTTAATTTAGTAGGTTGAAAAATCTTAAAAACTCACCC AACCCACCTGATGTTCACCCCTACTAAAAAAATTTTAGATTGGATTGGACGCACCTACTATGTTCTCCATGGGACTCTAT GCCAAGCATTGTCAAACTAAGGTTGTAAATAATAAAAAAGTTTAGGGTCTAACTTGTAAATTATGAAAAGTTGAGGGAGA TGAGTGCAATTTACCATATTAGGCCATACAAAACCAAACTCCCAAAGTTGGTGCTGGAAGTTTTCATTTTTTGACCTTTC TTCACATGTCAATTCGTCATTGTTACTTATAAAAGAAAAAAAAAATGGTCCATTTTACTTCTCTTACTATCTCAAGCAAG GCATAAACCACATATGATGCAATACTACTACTCCTTGACCCACAACTTGCGGTTTCCATATGGGATCACTCAACATATAT ATATATATATACATTTTTTTTTCTTTAAATCACACAACATATATAGTAAGCAATCCTATTTGTTAATTATTCAAATCTCT GCATACTATATATAATTGGCATGTGATCCTGAGACAGCTAATATTATTATTAAAAGAAAAATCATACATATCTCTGCTAG GATAATCCATTATTTTAAGTATGCTCAAAGGCACAACATGATATTAAAATGTTTACACCTTCTATCAGACCTTTTAACTT TTAAGTTTTAATGGTAAGGTGATGAACTTTGTTAAGAATAAAGGACGAAATGTAGTAACACAAATTTTTCCGATGTCACT AATTCAACTCAGTCTATTTTCTTAATAAATGAATTAACCCAAAATTGAGGAACAATTGAAGACATGAAAGAAAATGTAGA CTATTTTTGAATTAACCGAAAATTGATGAGCAATTGTAGACATAAATAAAATGTAGATCCTTGAGTTTTTAAGTGAGTAA TTGTTTGCTCGTAAATATAACTTTACGTTAAAATTCATACAAAATAACACGTGCGTGAGTGGCCTACTTCTCAAAGACAA GAGTAAAAAACTAAGCTCATAAAAACATAAAAAATAAAAAATAAAAAGATGAGAGAGACCCTAAGGCTCACGGTGACAGG GTGAATCGTAGGAAGGAATTGCGGGTGGAACTTGGTTATGAGCAAGGGTCTCTCTTCCCTTACCCACTAGCCGATAAAAT AGGGTCGTTTCGTTTAAAATTAGATGATGCTTTTTAATCTTAACCACATTATACATACTACTAAAGGAGGCACCCTTTTT AGAACAGTGCCCGGTCCTTTTTATCCTTCTCTTTTGTAACAATTCCGGCTGTGTCCTAAAATTTGTTGTGATTGTACGAT TTTATCCTCGGTTTTAATTTGTTGCGGTTGATATTGTTTTGGGTTTTTGGTAAATTTATGCAGAGAGAGAGAAAGTGCAT GTGAGATGTTTGAGTGGTGGGCCTGGTTTCTGCAGAGAGAGAGAGTGGTGGGACCACAATTTGTTTTTACTATTTTGTCC TCAAATTTTTTTCCTTCCCGTATTTTTCTGCTGGGCATTTTTGTCATTTGTTGCGGTGGGTTTTGTTTAGTCTCCTCGAG ATCTTCTTGCTTCTTTCATTTGTTTCATGCCTCATTTCTCTTTTACCGATGCTCATTTCCTTCGTTTCCTGTGCGGTGGT TTTTGTTTAGTTTTCTTGAGAAGCTTCTTGCTTCTTTCATTTTTGATTCTACGCCTGCATCTAATGTCTCTTTTACCGAG GCTCTTCTTCTTCGTTTTCTCCTCACAAGTTCTCTTCGTTTTCTTTGTGGTTTTCTCTGGTTCATTGTGTTTTGGTTCTA AGTTTTTCTTTTTCCATTTTTTGTTTATGGATTTTGTTGCGCTTTTCGTAAGGTTAATTTTCGAATTTTTTTTTTTGACA AATGGGTTAAGGTTTTCGTGGGTTTCATTTTGGTTTCTTTTCTATGTTTTATGCATTTTTTTCCTTTTCTTTCTTTCTTT CTCTTCGTAAGACTTCTGGGAATCATTGTTAATGTTTGTTTTGCTTTGTAGTTTTATTTTTCATTTTTTTTATTTGGCTT CCTTTTTTTATTTTTTGATTCATTTTTTTCGGTCTATTTTTTTAGATCATCCCGTTTATTTTTCCAGACCAGTTATTGTT TTTGTAGATTTGGCTTCCTTTTTTTCATTTTTTTATTAGGTTTTTCTTTTTTGTTTTTTTTTTAGATCTGGATGTGTTTT TGCTTTCTTTTGTTCCTTGTTTTTAATTTTTTTTTTATTTTATGTTTTTGGGTTTCCTTGCGTTTTTCGTGGGGTTATTT TCAGATTTTTTTTTTTCACAAATAGGTTAAGGTTTTCGTTGGGTTCATTTTGTTTTTTTTTTTCTCCTGTTTTATGAATT TTTTTCTCTTCTTTCTTTGTTTCTTTTCATAAGGCTTCTGGGAATCATTTTTAGTGTTTGTTTTGTTTTGTAGTTTTGTT TTTCGTTTTTCTTTTCTTAGATCTGGCTTCATTTTTATTTTTTTATTTGCTTTTTTCTTCCGTATATATTGTCAGATCTG TTAGTGTTTTTGTAGATTTGACTTCGTTTTTTTTCCGTTTTTCCTATTCGATTTTTCTTTTTCATTCTTTCAGATATGTA CGTGTTTTTGCTTCGTTTTGTTCTGTGTTTTTTAATTTTTTTTTTCATTTTTCTAGATCTGTTAGTATTTTTGTAGATTT AGCTTTGTTTTTTTATTTCAGTTATTTCTTCATTAGGTCTTCGAAATAATCAATTTTTACTTTTTCCTTTTTTTCTATTT TCATCAAATTTTATTCATTTATTGGTTATTACGTTGTCTAACACTTGTTTTTACTAATTATTATATGTTTTTATATTTGT TTGCAGGTTATATTAGTTGGGAAAGACATTTGTTTGTAGTGCAGGGTAACTCTTTTTAACGAGTTATTCTTTCTCACTAT CTACAGGTTTTTCATTCTATTCCACGGTAATTATCATGCAGCGTAACACCTATTTTTAACAAATTATTACGGTTTTTTTC ACTCTCTGCAGGTTTTTCGTTGTGTTCCACGGTAGTTATCATGCAGCGTAACACCTGTTTTTAACAAATTATTACGTTTT GTTTACAGCGTAACAACGGTGATGTTAAGTTTTGTTTCTAGTATTTACCACCACCACATACTCGAAAATTTATTTTTTCC CTATAAATATATTGTTTCCCCTTTCACGTTCATTGTCTTCTGCTTTGTTTCTGTTTTCGTTGTGATACACTTATCGTCTA TCCTCTCTGTTTCTTTTCTTTTCTTCAATTTTCAATTGTTAGTTTTTTTTCTCTCCCTTTTCTATTATCTCTGCTTTGGA ATTTTTTTACTCCTCCTACATCAACTCTATCCACTTTCATCGTTATTCTAAGGTACTCTTCTCTTACTTCTTTCATATCA TTTCTAATTGTTTTTAAAATTGTATCTATTATATTATTATGCTTTTGTTACTGTATATATTGAATTGTAAATATATGTGT TCATTGTTTTATGTTATTATGATTATATTTGTACTAATTCTATTTATTATATTAATTTGTCTAACACTTTGTTCTATATC TAACATGATTTCTCATTTGGTAATGATGTAGTATTTTTCTTTTATTGTTACCATGTATTAAATAACTGTTTATAATGAAT TAGCAAGCCTTGACGTTGCCCGGATTATTTAAGATTTATATTCTTTTATTTATTTAGTTTTGTCAACAGTATATTATTTT TATTATCATTTTCTACTCTTAAAATGATTTGTTCTTCATCTGATTTTGCTGAAGGGTTTTCATTCTATTTCTTTATTACA GTCTCTATTGTTGGTTTGCCAATTTAAGTTATTTTTATGTCAATTTTTTTTTTCATTTCTTTTTCCTTTCTTAATCTTTA TAAATCTTTTTAATAATTCAGTTGGCACTGAAGGGCATTGTTAAATCTTATTCTAGTTACTTTTAATGCGTGATGTTAGC AATTAAAGACAAATACCTGAACTAAATTGTTTATATTTATCTATTTAATTTCCTCATCTATTTTTTAAACTATTATTTAT ACAATTGACTACTACAATATGTTCTCCTTAATTTGTCACTACTACAATATATGTTGCTTTCCTGCTGCCATTGTTAATGT TAAAAAGAAACTCTTTAAGTTTTCATTTTTAGTTTCTCAATATTTTTTTAAGTATTTTCACATTTTTCTTCTCTTGAATT GTTGCAGTCACTCTTTAGGAAAGAGTTGTTTCAGAGAATTGTCTTTCTTCTAAGGTACTTTTTTTTTTTAATTCTGTCAT GTTATTTCTGAGTGTTTTTAAAATTTTATGTATTATATTACTATGCTTTGTTAAGTATTTATATTAAGTTATTAATATAT ATGGTCACTATTTTATATAATTATAATTATATTTGTAATGAGTTTGTTAATATTATTTGTAAAACATTATTTAGTGTTTA TATTACATAACTTCTTGTTATTTGACTAAAAGTTAGATTTCCTTTATATTTCTTATATTAATCTGTTAACATTTTCTTTT GATGCAGAGGACAATTTTTATGTAACATTTATAAAAATATCTTCATCTAATTTTATTGAAGAATTTTTCTTCTACTGTTT TTATCACTACCTCTATTCTTGGTTCGTCAATTGAACCCATTTATTTGTTTATGGAACATTTCGATAGATTTAGTTCCAAT CACACGGTTGTAAATATTCTTTTATGTTTTTTATATTTGTATTATTTATGTTATCTAATCTTTTTTATGTTTTTAGTACA AATTCTGTAATAATTTAGTTAGTATATGTTATTAGCAGTAAAATATAAATACTAAACTATTATTTAATTTTGTTAAACGG ACAATTTTCATTTCAGTCCTTAAATGTTGCTTCTGTTATTAATTCATCAACTGAACGTATACCTTTGCAGTATTCCTTAC TTTTTTTCCTACGTTTTTTATCTTCCTAAATAATATCTAAACAAAATAACATTTAAAGTTTTATTTTTAAGACATTTATA CGAAAACATTGTTTACATCTTTCTAAACAATATAACATTTAAAAGACATTTTTACAAAAACAGTGTAAACAATATGTAAA CAATGTATGTTATTCTCATACAATATACAACATTAAATTTTATATACAAAAGTATAATTAAAAAAGTATAAATATATACA ATATTTGAATGTTAACGTGAATCTATTGTAAATAATATTATTTTTTTTTGTTTTTTATAATTCACAACTTTAATATATAT GTACTAATTAATAATACACATTTTTAATATATTGTGCTTATTTGAAATAGATTTATTGTTTCGTTTCAGTTTCTACCGTT GACTACAAATTTGAATAGTATTTGTGTATGCCTGACACTCGAGTTGTGCTTAATTCTCTCAAATACAAACGTGAGCCCTG TAACGACAGAGATAAGTTTTAAATGTTTTATTTATACACTGTTAATATTTTATATTTGTTTAAAATAAATTTATTAACAT ATATAACAGATTAAAAATAAATTATTTATATTTAACTTATTATATATATTTAACAAGTTTTTTAAAGATTTATAAAAAAA TTTTAACGTTAATTTTCAAAAAGTATTTCATTTTATCTAATGATAAAATATTTATATAAATTTTATATAAATCGATTATT TTCGTTAATAATGTAATACATATTTGTTTATACTTCTTTTGTAGTATTAATTATATTATATCTATTTATTAATATAAAAT TATTTTTTAATTATAAAATGCTTATACCATTTAATTTTTTTGTCTATTATAATTTAAAAACCAAAAAAAAAAAATTGTAA TTCTTTATTATATATTTCTTCTAAATATATCTTCACACTACCTTCATTTATTTTATCATTTGTTATATCTATTATTTCTT CTTTTCTATTAATTTAAATATATGTTTAGATAAATATTTGTTAACTATAGAACATAAACATATTACAGTGTTGATTACAT TAAAATTTTAATAAATATATTTGTATCAACACTTTAAAAAAATTCTCTAATGTGTTCCATTATAATTGAGCATAAAACAC TTAAATATATATTAAAATAATAAACTAATGTTTAAAATTTAAATTTTATTAATAATTTTACTAACTAATAAACATTTTAT TGTATTAAAATTGTTTTAAATATAATTTACAGATAATAGAAATGAAAAGAAAGTTCAACCGAAATTTTCTCCATCAAAAA ACTACGAAAAGTGTCAAAACAAAAAATGAGGACGACCGAAATGCATCAGTCAGATTCGGAAAACATGAGGACACGTCGAC CCAAACCTACATAGTTTTGTGGAACTTTCATCAATACTCAGATCCCTTTAGAACCAACAATTCAACAGTCAAATACAACG CTGGTTGAAGAAAGTAATTCCTAAACTTAAAATCTTTGTCTCTAAATTGTTAACACCTCTATTTGTAACTAATTTAAAAT TATTTATGAAATTATGAAATTAGGTGATCTAAATGCGTATATTGATCTTGGAGATTGTGACTCAACATGTGAACATTGTG GAGCAATATTTTGGAATAATGAACGAACAGAAAAGTATTCATATAAATATTCTTCATGTTGTCAAAATGGAAAAATAAAA TTACCTTCTAAAAGAAAAACATCACTAATTTTAGATGAATTATTAAAATATTATGGTGGAAATCTAAGTACACATTTTAA GAAAAATATAAGAATGTATAATTTAATGTTTTCTTTTACATCATTTGGGGCAAACATTCAATCAAATATTAATGAAACAT TGGGACCTTATATATTCAAGATTAGTGGTCAGACACATCATTTAATGGGATCTTTACTTCCAGTTGATAACAATCCTCCA AAATTTGCACAATTATATATTTATGATACAGAAAATGAAATTCAAAATAGAATGTCAATATTTACATCAACGAATAGTTC AGATTCTTTAAATGAAAATATTATTACAAAATCAATAACAATGTTAGATGAAATAAATATATTAGTTAAATTATTTAGAT TTGTTAAAAAATTTTATAACACTGACAAAACCCAGTCAATGCAATTAAGATTAATAGGTAGACGAGAAGGGGATGGTACA CAATATGACCTTCCAACTTCAACAGATATAGGAACTTTAATTGTTGGTGATATTGGTGAATATGAAAAAGGAAGATATAT TATTATATGTAGTCAAACAGGTGACTTACAGAGAATTAATAAACTCCATCCATCTTACATGTCATTACAATATCCTTTAT TATTTCCATATGGTGAAGATGGATATAGACCTAATATAGGATGAAATCCTAATTTTGTATTGACAAAACCATCTAAAAAC TGAATTTCAATGAGATCATTTTATGCTTTTCAATTACAACAACGTTTAAATGAAAGAAATACATTGTTTAAAAGTAGTAG ACTATTTCAACAATATATTACAGATGCCTATGCTACTGTTGAAGAAGATTGATTAGACTTTATTAGACAAAACCAAAATA ATTTGAGATCTGAATTTTATAAGGGTATTCAAGATGCCATAACTAAAGGTGATACTGACCCTCAAACAATTAGAAAAAGA ATTATTTTACCATCATCTCATACTGGAAGTCCAAGATATATGATTCAAAACTATCAAGATGCAATGGCAATATGTAGACA TTATGAAAATCCTGATATTTTTTAACATTTACATGCAATCCTAAATGGCCTGAAATTATAAGAGCTCTAGCTGTACTTCC GGGACAAAAATCTAATGATAGACCAGATATCATAAGTAGAATTTTTAAAATAAAATTAGATCATTTATTACATACAATAA AATATGGACAAATATTTGGGACCATAATAGTAGGTAAATTATTTTATTTTACCCTAAACTTTTATATTCAATTCTGTTAT TGCTTAAAAAAAATTTACATTTCTTTAAAATATGTTTCTAACTCTTTTTATGTCAATATTTTTTCTATTATTATAGATTT ATACATTGTCGAATTTCAAAAACGTGGTTTACCTCATTGTCATATGTTATTTTGGTTACATACTGAAAATAAATGTTGAT AACCAATATAGATAGACAAAATTATATCAGCAGAAATCCCAAATCCAGAATATGACCCATTAGGTTATAAAGTTGTTACT GATTTTATGATACATGGCCCGTGTGGATATACAAAAACAAATGCTCCATGTATGAAAAATTCAACATGCACTAAAAAATT TCCAAAACAATATAAAAATGAAACAAGCATAAAAGAAAATGGTTTTGTTAGTTACCGACGTAAAGAATCTAATTTTAATA CTATTAAAGAAGGAATCCAACTTGATAACAGATTTGTTGTTTCATATAATCGTACATTATGTATAAAATATCAAGCTCAC ATAAATGTTGAAATATGCTCTCAGTCAATGCTCATAAAATACTTATTTAAATATTTAACAAACGGACCAGATAGAATAAG AGCTGCTATTGAAAATACAAACATTACAGATACTACAAAAGAAACAAATACAAAAGAAATTGATGAAATAAAAACATATC TTAATTGTCGATATATTACACCCTATGAGGCAATTTAGAGATTATTTGAAAACCCAATACATCATAGAAATCCAGCTATT CAACGACTTACAATTCATCTACCAAACATGCAAAATATTACATTTAATAAGAATCAACAGTTACAAAATATAATTAATTT ACCACACAACAAAAAAATAGCACTGACTGAATGGATGAAAATTAATAAGACACATGAAGAAGCTCGACAACTTACTTATA TAAAATTTCTAACAAAATGGGTTTGGAAACACAAAGATAGAATTTAGACAAAACGACAAATTGGACACATTATTAGAAGA ATGTTTCATATTCCTCCTGGTTCGGGCGAATTATTTTATTTAAAATTATTATTAAACCATCAAAAAGGTGTAACAAGTTT TGAATCAATTCGAACAATTAATAATATTATTTATCCAATTTATCAACAAGCATGTCATGCATTAGGTTTATTATGAGATG ATAAAGAATGGAATGAATCAATTGAAAAAGTATCATTTTGGTCAACATCTATTCAACTTCGTTAACTTTTTACTATTATT TTATTATTTTGCAATGTATCTGATCCAATTAAATTATTAGAAAATCACTGGAACCTAATGTGTGATGATATTATATATAA AATAAAAAAATCATTCAACAATTCAAAATTTCAAATTCCAGAAAATGAATTATACAATTTTGTATTATATGATTTAGAAA AATTATTAAATTTAAATTCATCTTCTTTAACAAATTTTAACATACCACTTCCAACAGGATCATTAATTGAAGATTTAGAT AATAAGCTTATAAGAGAATAACTAAATTATGATAAAAAAAATTTAAAGAAGAAAATATAAAGTTAATAAATAATTTAAAT CATGAACAATATTACATTTACAATGAAATTTTAAAATCACTTAAAAACAACAACGATAACTTATTTTTCATATATGGATA TGGAGGTACAGGAAAAACATATTTATGGAACACACTTATTAACAATATTAGATCAGAAGGTGAAATAGTATTAGCAGTTA CATCATCTGGAATAACATCATTACTTTTACCAAATGGTCGTACTGAACATTCACGATTTCGTATCCCTCTTTTAGTTGAT AAATTTTTAACATGTCAAATTAAAAAAAAAAACACTCAGTTAGCAAAATTAATAGAAAAAACAACTTTAATATTATGGGA CGAAGCACCAATGAATAATAAATATTATTTTGAAGCTTTACATAAAACAATGCAAGACCTAAAAAATAACTTTAGTCAAC CTTTTGGAGGAATGACAGTTATTTTAGGTGGTGATTTTAGACAAATTCTACATGTTATTCTAGGAGGCACAAAAGAAAAC ATTATTGATGCAAGTATAAATAATTCTTATCTTTAGACATATTTCTGTGTATTAACATTGACAGAAAATATGAGATTAAA AATTTCAAACAGCTCTATTGATGAACAAACTGAAATAACAAAATTTTCTGACTGGATATTAAATATTAGAAATGGAATAG TTGATGGAATAAAAGATCCAGAAAATGAAGACGCTACTTGGATTAATATACCTGAACAATATTTAATAAAATATGATGAA AATCCAATTAAACAAATTTGCATTGTAGTAAATGATGATTTTGAAAATAACTATGACAATATTAAATACATAAAAAATCA TGCAATTGTAGCACCTAGAAATAAAACAACATATGATATAAATAACTACATGTTATCTTTAGTACCCACAGAGAAGAAAA TTTATTATAGTTATGATACAATTATTTCCTCATCTGGAAACCTTGATGAACTAAATCTATTATACCCTCCTGAATTTTTA CACACATTAAATTTTAATAATTTACCACCACATGAATTGAAATTGAAAATAGGAATTCCTATTATTTTATTATGAAATCT TAATGAGTCACAGGGTTTATGTAATGGTACTAGATTAATAATTACCCAATTAACAAATAGAATAATTGAAGGTCATATTA TTAACTCTATTGATACAAATATTAAAGTTTATATACCTAGAATAGAAATAACTATAAATGAATCCAAATGACCATTTGTT TTAAAAAGACGATAATTTCCTATAAAATTATGTTACGCAATGACAATAAATAAAAGCCAAGGTCAATCATTAGAAAAAAT CGGTATATATTTAGAGAATGAAGTTTTTTCTCATGGACAATTATATGTAGCTTTATCAAGAGTTACATCCCCAAAAGGTT TAAATATTTTAGCACATGAATCAATAAACAAATATCCAAATTATATCAAAAATATTGTATATAAAGAAATATTACATAAT CTTAATAAAAATTAATCTACTTATTCTTTTATACCAAAAATTTTCTAATGTATATAATCTCACAACATTCAACAAAATCA TTTTCTAATTTTTAAAGTATTATTGTAAATTTTTATAATATAATATTCTTTTCCATTTATATATTATAAATTTTAATATC TTTTATATTATTTTATAGTTTCAACAAAATGTTTGCACCAATGAGAATTCTGAAACCTGGTGAAACACACTTGACTATTC GTGCTCGAATATGTCGTTTATGGAAAAACGTAGATTACAAGACAGGAGAACTTTTCAGTCTTGATATATTGTTGGTTGAT GAAGAGGTAATGTAATATACTCTTTTTATATATTACATGATTAAAAATATATAACAATCGGATATATTTGTTACTCAATA TATAACAATAAAAAATATGCTTTATAATTTTACAACATGAAGCAATACATGTAGTTATTCGATCAAGAGATGCTGACTAC ATGAGCCAAATAATTGAAGAAGACAATATATATGAAATTAATAACTTCTTCATCAATCGAAACAAACCAAGATATAAAAT TGTTCCCCATGTGGCAATGTTGCGGATTGCTAGAGCAACAATTTTTAAACATGTTCCTGAAGACATGCCTGAAATACCTT GACAAAATTTAATTTTGTCAAATTTTGTCAAATTCGATCTAATTTCTCAAAGAATCGACGTAAACGACGTTCCCTCAGGT TTGTTTATTTTATAACCTATTTATTTATAATTTTTAGTCAATTATTTCTCATTTTATAATAGTTAAAACTAATTGATTAT ACATATAATATTTCTATCAGATGTAATAGGTCGACTTACATCCTTCCATGGTATTGAAGAATCAGCCATAGTGAAAGAAT TGTCAAGAGAAGAAGTTTCACAATTCAAAACATAAGGTAAATACAATAGAAACTATTATTACTATAATCAAATAAAAAAT TTTATTCATATTTAAATATTTATAATTATGTTTTCCACTGTTTAATACAGAGAAGAACAATTGAATATAACACTTTGGGG AGAAATAGGAGAGCTTTTTGATGAAAATGTTGTGCGGTCAATGATGGAACCAATTGTTGTTGCTTTTACAGCAATGGCAG CCAAACAATACCAAGGTTATTATTTATGTTACAATATATTCTTTTAATTTCTTATACAACTAACTATACATTTTTATTTA TTACAGGAGGTCTTTACTTATCAAACACATCTGGTACTTTTTACTTCTTAGATCCAGAAATACCAGAAACACGGAAAATT AAACAAAGGTATAACAAAAAATATTAACTTTTTACTATTGACATATATGCATTTTCTCATTTTTATTTATTCATATAAAC ATAAATATTTACATACATATTCCGTCATTCCATTCAGAGCTTAGATTACATTGCCACATCAACAAGACCAACAATATCAT TAGAAGACCAAAAGATCACAAATCGTATCACCATCGTAGAATTACGAGCATTAAATCCATTCCAAAATCGGGTATAAACT TTATCAATACAATTCATTAAATATAATATATATATATATATATTGAATTAAAATGTTTATTTCTCTACTTAATAGGAAAC AAAATACACAGTTAAAGCAACTATGACTTATCTGAATACATATCAAGGATGGTTCTATTATGCCTACACAAAGTGTTACA GACAAGTGCAAGAATCTGGAACATCATGGTGGTGTGATACTGACGAATATCTATATACAATGCCATTAACTTGGTAATAA ATTATGGTACAAAAAATAAACAAATTAATTTTTAATTAACAAATATAATAAATATATTTGATTTTTTTTACACAGGTACA AAAGAAATATACAGATCGAAGATAGTACTGGAAGAACAGACGCTATAATGTTTGGTAAAATAGTACAGTCACTTATTAAC AAAGCTTGCTCTACACTTACTTACGATGAGGGATACACTGATCGTTACATGATTCCTCCTATTTTAGAATAAATAAGAGG AATATCAAAAATATTCGTCATACAGTTTCGAAGTTGAGGAGCTTTTATCGATAAAGTTATTTTGAAGACTTTCAATGACG ATCAGCCTCAATTGTTCTTACCACCTACAACAACTGAATCTTCAAAAGAGGCAGCATCAGTTTCAAAGCCAATTCACGCT ATTTCAGTCCCTCACGAATCTACCTCTTTCGCAAGTTTATCGAAAAAAAGAAAGCAAATCAGGTAAAATTATATGTTATA TATTATATTAAATATTTAAATTAATATGCACACAATTATTAACATTTATTACAATTTAATAATAACTATTTTATTATTTC CTTTTTTCTTAACTGCAGCTCAGAAGAAACAAAAAGCCAAAGCAAAAAGAAGTAGATATATGAATAAATCTGTGTATATA TGTAAATAAGTTTGTATATTTTTACTTAGAAAAATTGAGATATAAATAAATGTGTATATATGTGTTACAAATTTACAACA ACTTATAAACATATATATATATATATGTGTGTGTGTTTTTATATAATTTTTAAATTTAAATTGCTGTTAATTAAACTATT ACATATCCGTGTAAATGCACGGGTAATCCACTAG >DHH_10_2_Mno length=2585;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTTTATTATATTGTAATTAAATAGTTAAATCAATATATGAAATATCTTTTTTATCAATTTTATTTTTACATTGTTAACA TTTTATAATACCATTATTATTTTATAATATCTATACTTTATATTTTCTATATTATTTTTCAGTTTGAACAAGATGTTTGC ACCAATAAGAATCCTAAAACCTGGTGAAACACATTTGACTATTCGTGCTCGAATATGTCGCTTATGGAGAAATGTAGACT ACAAGACAGGATAACTTATCAATCTTGATATACTCTTGGTTGATGAAGAGGTAATCAAATGTATTCTTTCTATACATTAT ATAGTTATAAATATATAGAAATATATACATTTATTATTCAATTTATAACAATAGAAAATCTAATTTACAATTTTACAGCA CGAAGCAATACATGCAGTTATCCGATCAAGAGATGCTGACTACATGAGTCAACTAATTGAAGAAGGAAATATATATGAAA TTAGCAACTTCTTTATCGATCGTAACAAACCAAGATATAAAATTGTTCCTCATGTGGCAATGTTACGAATAGCTAGAGCA ACACTTTTCAAACATGTTCCTAAAGACATGCCTGAAATACCTCGACAAAAATTTATTTTTGTTGAATTTGATCAAATTAC TCAAAGGATCGATGTAAACGATATTCTCTCAGGTTTGTTTATTTTATTACCTATTTGCTTATAATTTTTAATCAATTATT TCTCATTTTGTAATTGTTAAAACTAATTGATTATATATGTAATATTTGTATCAGATGTAATTGGTCGACTCATATCCTTT CATGGTATTGAAGAATCGGCTATCAGTGAAAGAATTGTCAAAAGAAGAAGTTTCACGATTCAGAACATAAGGTAAATACA GCAAAAATTATTATTGTAATAATAAATGATAAAAAATATTTATGCTTAAATATTTATAACCATGTTTTCCATTACTTAAT ACAGAGAAGAACAACTAAATATAACACTTTGGGGAGAAATTGGAGAACTTTTCAATGAAATTGTTGTGCAGTCAATGACG GAACCAATTGTTATTGCTTTTACAGCAATGGCGGCCAAACAGTACCAAGGTTAGTACTCATATTATAATATATTATATTC TATTTTTTTTTATAAAGCTAACCACAAATTTCTATTTATTACAGGAGGTCTTTACTTATCAAACACATCTGGTACTTTTT ACTTTTTAGATCCAGAAACTCCAAAAACACGAAGAATTAAACAAACGTATAACAAAAAATGCTCACTTTTCTCAATGTTT ACATATATGTATCTTCTTATTTTCATTTATTAACATAAGACAAATTCTTTTTATATAGATTTCGTCATTCTATTCAGAGT CTGGATTATGTTGCTACATCGGCGAGGCCAGCAATATCATTAGAAGACTAAAAAAACACAAATCGCATTACCATCGCTGA ATTACGAGCATTAGATGCTTTCCAAAATCGGGTACAAAGCTTATAAATATAGTCCATTAAATATAATATGTATATATATT AAATTAAATTATTCCCTTTTCTACATAACAGGAAACAAAATATATAGTTAGAGCAACTATAACTGACTTATATACACATC AAGGATGGTTTTACTATGCCTGCACAAAGTGTTATAGACAAGTACAAGAATCTGGGACATCATGGTGGTGTGACACCGAT GGATATCTATCTACAATGCCACTTACTTGGTAATAAATTCTATTATAAAAAATAGGCGCTTTAATTTCCTACTAATAAAC ACAATAAATATAATTTACTTTTCTTATACAGGTATAAAATAAATATACAGATTGAAGATAACACTGGAAGAACAGACGCT GTAATGTTCGGTAAAACTGTGCAGTCACTTATTAATAAAACTTGCTCCACACTATGATGAGGGATACACTGATCGCTACA TGATTCCTACTATTTTAGAAGAAATAAGAGGAATATCAAAAATATTTGTCATACAGTTTCGGACTCGGGGAGCTCTTATT GATAAAGTTATTTTGAAGACTTTTAATGACGAGCAACCTCAGTTGTATTTACCACATATAACAACTGCGTCTTCAAAAGA AACATCATCAGTTTCAAAGCCAATTCAGTCTGTTTCAGTCCCTCACGAATCTACCTCTTTCGGAAGTTCATCGAAAAAAA GAAAACAACTCAGGTAAAATTTTGTAGTATATGTTATATTAAATATTTTAATAAGTACGAACACGTTTATTAACAATTGT TACAATTTAATAATATTTATTTCCTTATTTTTTTTCCTTCTTATCTACAGCTCAGAAGAAACGACGGCCGAAAAGAAAAA GAAGTGATTACATGAATAAGTCTCTATATATATGTAAATAAGTATGTATATTTTTATGTATAAATGTAATCATCTAAATA AATGTGTATATATGTATATGTATATATATATATACGTGTTACAGATATACAACAACTTATAAACATATATATATATATAT GTGTGTGTGATATATGTGTGTGTGTGTTTTTATACGCTTTATTTATTTAAATTACTGTTAATTATACTATTACATACCCG TGCGAATGCACGGGTAATCCACTAG