>DHH_1_1_Mno length=24477;Class=DNA transposons;Order=Helitron;superfamily=Helitron; TCTTTTTATTATATATTAGTGATATCGAATGTATTGATTTTCTTTGCTGCTATTACTTCCTGTTGTTTATTACAGTGCTT AAAAAAAATATCCTTTTGTTTTTAAGATTATCCTTTTTTGTGTTTTATTGTTGTATAGCTATGGCATATTGATTTCTTAT TAATTTCTTCTATAGTCACACAGATATATGTGTGCCTATTTTTTTTAACATATTTTATCTTTATTTACTTTTGACCCTAG GTGATGATGATTATAATCGATTTTGGCCTCCTCATTCCTGTTTAATCTGTCCAAAAATTATTGTGAATAAGTCCCACTTA TTTAGATCTTCATTTTGCCTATCCTTTTTTACTGGAACAGTTTAAATGTCTTCTCTTCTTTTCTTTAGCGTCTGGCAGTG ATGACGGTAATTGGTTTTAGATTCTTGAGTTTCACCTAATCTCTCCAAAAATTGATGTGACTAAACTCTGCCTATTTGGA TTTTGATTTTTTGTTATACTTTTGACTAAAATAATTTAAATTCTACCTTCTCTTCTTTTGGCCTTCCTTAATTTAAGGCT ATTGCATTTTAGATACCTATTTGAATTCAATTCAGATTTGATTTATTTCTGTTAACTCGATTTCCTCATTATATTTCTCT CATGACCTCATGAATTTTGATTTTCAATACACAAATAGCATTACTGTCACTATTTTCGTCCCTGTTATTTTTTACAATAT TCATTTCTTACTTTTGGGCTTTTACTGTTTTTGTTTTCACTATTTCATTCAAAATATATTCCTCCATATTATATATCTTC TTATCCTATTTCTCTTTCTTGTATTAAGTCTTTTATTTGCACCACTCTGTTCCTTTTTGCCCCCCTTCTCCCGTCCCATT TTTTCCCCGTTTCTTTTTATTTTACTTTGCAAAAGCTTTTGGGCTTTCTCTTTGGTTAGTCGATTTCCTATACATTTTTC TCCTATATGCTTTCATTTTCCCCATTGTTGTTAGCTTCAGCTTTCCAGATTACTTTGATCCAAATGGAATATGAGTATTA ATTGATTATTTAATGACTTCATTCCGCCCACTTCCTCCATTTTACTTGGCTGAAACATAGCACCACTGCGCGCTATTGAC AGAGGTGCAGTTTAGCATTCACTGTTCGGTCATTTCTGTCCAACCCATTGTCCTTCTGATGTTCATGTTTTTCTCCTCTT TTCTAATTCACTTGGTAGTTTTTGGACAGATTTATATTTTGTTCCGGCCCTTTATTTTGCATCACATAAACGTCATAACC TGTATGGTAAATATAACATCTGATTAATTTTTGTGCTTTTATGCAGTTGTCCCTAATTGGTTGCCATAAAATGGTCATAG AAATACAAATCAGCTGATTTGCCATACATTGTTGATAACAATTGATGTCTCAGCCATAATTAGTCCATAAAAACATTACA AAATTCATAATTTATGAGCTTCCTCATATTCAATGTTCTTATTAGTTATTTGTTTACTTATATCTTGTCATTAGTTTGCT TTTGGTTCTTCCTTTTTGTGAAGTTTAGATAATTAGCTTCTACCATGGAAAATTTTCCCTCTGCCTGTTTATAAATAAAG CAAGCAGATGAAGACAAGGGAACACAACCATAAATTTATTGCTTTATCTTTTGTTTGTTTATAGGTTTAATTCATATACT ATTCTTATCTTATTGATTTGTTTTGTAGAAATTCACATCTAATATTGTAAATTATAAATTTCCTTTATTCTAAACATGTG AATATTACAAATATTTTTATATTACTTTATTTAGAATAAATTGTATATGCAAACATGCAATTTTGTGCATTTGCTCTGAA AAAATTATCTGTGCAATTATTTGTTCCTAACTTTAATATATTCTAAATATATATTGTGATTACGATAAAATTTTACATAC ACAATTAATTTGAATTGCTGCTTTATTTACTTCTTTTTATTTTTTTCTTTAGTTTTAGACGATAAAATTTAAATGTTTAT TTTTGTGTTATAATTCGTAGTTGCTCTCCATGTTTACTTATTCTTATTATTTTCTATTATTCTATTAGTTATGTATGTAT TCATGTACCTATATTTATGTAACTTTCTTCAATAAAAAATTAATTAAAGATGTATAAAATATAGTTTTCATAATTTATAA TGTAATAAGAAGATTAAAATAATAATTAATTAAATGAACTAAAAATATAAATATAAATATAGAATATGAATTTAGAAAAA CGCATATTTAATTTATGTAACAATTTGCATATTTTATTAATATTTAATGCATAAATAAAGCTTTAGGGCATGTTCTTTTA TCCAGAAAACTCAAAAAAAGACAACTCAAGTTTCAACTTTATTTAAATTTACGTTTTTTTAAGTTTTAACTTTATTCAAA GATGATATCTTCTTTTTTTAAGTCCCCTAGATAATTTCATATAGCGGTTAATAAATGGACAAACAAATAATCATAAGAAA ACGACGATGATTGAATCATCGTATGGATAGTGTTGCTTCAGGAATGGATCAAGATTTCAACAACGTGATTAATCAATGTT CAAGTCAAATCAACGAAAATATTGAACCTGCATTATCAACTTCTCGAACAAGATTCTACACAATGATCTCACTTTTGCAG TCTCCAAGAAATCTTCTATCACTTTCTTCGTCATCTGAAAACTACAATAGACAACGTAATTCCCTTATATATACTAACTA TTAGATTCAAGTAATTACAATTTTTTTTTATAATAACAATACTAATTTCTTATATGTTGTTCCCATTACCATTTCGGATT CCTGTGCTACTAATATGTACATTAATCTTGGAGACCACTTTTATACCTATCAGGACTGCGGTGCGTTGTTCTAATTTCAT GAGCGAATTAAGAATAGCAATCCACCTAAATATAATCTTTGCTATAAAGATGGAAAAATTATTTTACCCTTGATGGAAAA AACACCTCCTACACTAGATCAACTACCCAATTATCATGGAGGACCAATAAGCACACATTTTCAATATATATATATATATA TATATATATATATATGAACATATAATTCTATGTCCGCATTTACATCTTTCGGAGTTAATATAGAAACAAACACAAGAAAT TCAGATGGTCCATATATTTTCAAAAGAAGTGGACAAATACATCACCTTATCGGATCTCTGCTACCAACTGATAATAATCT TCTGAGATTTGCGCAACTCTATATATATGAAACAGAAAATGAAATTAAAAATCGAATAGCATCATTCTCATTTGATGATC AATCAAAAGATTTGATATTAATAGTTGAAAATTTGATTAAGATGCTTGATTATACAAATAAATTAGTCAAGCTTTTTCGA TTGATTAGAGATAGATACAGAGAAAATGAAATACCAACCATGAAGCTAAGACTTATAGGCAAAAGATCCACATATAGTAA CCAATATGAACTCCCTACTTCAAACGACATAGGTTGTTTAATAGTTGGAGATATTGGCGAATATGAGTAGAGGAGAGATA TTATAATCAAAGATAGGACAAATACTTTACAAAAAAATTACAAAGTTACATCCATGTTACATGGCTCTTCAATATCCTCT ATTATTTCCTTATGGAGATGATGGTTATAGTAGATTTGAAATATAATACAGGTAATTCAAATACCAACTCCGCAAGGAAA AGAATCTCTATGAGAAAATTTTATTGCTATCAGCTACAAGAACGCAATATACAAGGCAACACTCTTTTTCGAGGAGGCAG ACTGTTTCAGCAATATATAGTCAATGCATATGCGTCTGTAGAAGATGATCACTTAGACTATGTTAGAAAAAATCAAAAAA AAAATTTAAGATCTGAGATTTATCAAGGAATTCAAGATGCTATTACAATATGAGATATAAACGCTCAAGCAATAGGAAAA AGAATTATTCTTGCTTCCAGTCATACTGAAAGTCCTAGATATATGATTCAAAATTATCAAAATGCAATGAAAATTTGCCG ACACTATGAAAATCTAGATTTATTCATAACATTCACATGCAATCCAAAATTGCCTAAAATTACAAGAGCTCAAGCAAGAA TACTAGGGCAGAGACCTGAAGATAGACCAAACATCATTAAAAGAATATTTAAAATAAAATTATACCATATTTTATCCACT ATAAAAAATTATAAGATATTCAGGACAATTGTAGCAAGTTAGTTTACCTTTTCTAAATTTCACTTACTTTATCGACAGGA TACAAAAATCATTTACTATTTGTTATGCTAAACAGAAATTAAAACAAATTCCTCTTTACTTTTGTAGACTTATATGTTGT GAAGTTTTAGAAACAAGGCTTGCCATATTGTCATTTTCTTTTTTGGCTCCATCATGATGAAAAATTACGCGAGACATCAC AGATAGACAAATTTATTTCTGCAGAAATACCTGATCCCAACAACAATCCACTAGAACATGACGTTGTGGCTGAATTTATG ATGCACGGGTCATGTGGCATAGCTAAGCCAAACTCTCCATGCATGAAGAATGCAAAATGCTCAAAAACATTTCCCAAACA ATTAAGAAACGAAACAACAATTGATGAAAATAGATTTGTTAACTACAGGCGAAGAAACACAACCTTTCATGTAGAAAAAG AAAACATTAAACTGGACAACAGATTTCTTGTTCCATACAATAAAATCTTATGTTTAAAATTCCATGCTCATATCAATGTA GAAGTTTGTTCACAATCTATGCTCTAAAAATATGTATTTAAATATTTGACGAAAGGACCAGATAGAATAAGAGCAGTCAT AGAAGATAACATATGTGTGGAAAACACTACAGAAACTAACTACAAGGAAATAGATGAAATAAAAAACTATATTAATTGTA GATACATAACACCATACGAAGCAACGTGGCTGCTGTATGAATTTCTAATACATCACAGAAATTCAGCTATTCAAAGACTA TCAATATATTTACCAAGAATGTAAAACAAAACATTTCATTCAAATCAACGTCTGAATAATATAATAAGACAACCTGGTAT CGATAAAATAACTGTTACTGAATAGATGGAAACAAACAAACATGACATCAACGCTAGAAAACTAATATATATACAATTCC CAACCAAATACTTTTGGAATAGCAAATATAATATTAGTCTACTGGACAAATAGGACATACAATTTGACGAACTTTTCATG TTCATCCAAGTTCTGGAGAATTATATTACCCAAAATTATTATTAAATCATCAAAAAAGAGCAACAAGTTATGAAGCCCTT TAAACAATCGATAATATAACAAATCCAACAAACCAAGCAGCTTGTTATGCACTACGCTTATTAGATGACAGAGAATGGGA TGAATCAATATTAGAAGCTTCATTTTGGCCAACATCGATTCAGTTACAATAATTGTCTGTCATAATTTTATTATTTTGCA ATGTAAATAACCCAACAAAACTGCTCAGAAAACACTAGAAACTTATGACAAACGAAATTTTACACAAAATCAAATCCTTA TTTAATAACTCAAATTTTCAAATACCCAAAACTGAATTATATAATTTTGTATTGTACAAATTACAAAAATTATTAAATCT AAATGCATCAACTTTAACACATTTTAATCTACCTCTTCCCACTGGATCATTAATCGATGATCTAAATAATAAACTTTTAA GAGAAGAGTTTAATTACAACATAAATAAATTAAAAGAAGAAAACACTAAATTAGTACATAATTTAAATCAGGAGCAATGA TTTTTTACTAACAAATTCTAGAATCATTAAATAATGGAAAAAATGACCTTTTTTTCATTTACAGTCATGGCAGAACTGGC AAAACATATTTATAGAATGCAGTGATTACAAAAATTAGATTAAATAATGAAAGAGTTATTGATGTTGCATCTTCAAGAAT AGTATCATTATTACTGCCTAAAGGAAGGACCGCGCATTCTAGATTTCAAATACCACTATCAGTAGATAACTTTTTCACTT GCCATGTTAAAAAGGGAACCCAATTAGCGAAATTAATTGAAAAATGTCACTCATATTATGGGATGAAGCACCTATGACAA AAAAATATTGTTTTGAAGCATTAGACAAAACACTTCAAGATTTAAGAAACAATTATGAACAACCATTCGGTGGCACGACA GTTGTTTTAGGAGGTGACCTCAGACGAATTTTACCAGTTATTCCTATAGGAATAAAAGAGCACATAATAAACACAACCAT AAATAATTCTTATTTATGGCCACATTTTTTAGTTCTAACACTAATAGAAAGCATGAGATTAAAATGTCATAATGGCACAG AAGAAGAAAGAAAAGAAATTACAATATTTTCAGACTGGATATTAAGTGTCAGAAACGGCATTACTGAAGAAATAAAAGAT TTAGAAAATGAAGATGTTGCATTGATAAAGATACCAGAGCAATACATATTATATTACCAATCAAATCCGATTGAAAAAAT TTCAGCATTAACATATAACGATTTCAACAAGCATTTTGACAACATTGATTACTAAAAATAATGTGCAATAACAACACCAA AAAATAAAACAGCTGATGATATTAATGTTGAGAATGATGTCCTAAAAGTATGATATGTAATAGGATATTTATTATTTATT TAATAAGAGAGTTTATTCTTTATTTTATGTGCATATATTTATGAATATCAAGGAAAATTTCAGGATTATTTATGTGACCT TAAACATTGTATATAAATGTTATATACGAGAGGATAATGTTTAAGGATGATAATCAAAATGATGTTCGTAATGAATTTAA TTAAAGTTTAGAATCTTTAAGTAAAACATTATTAATACATGACATTCCCATTTAGAATGGAATGGTGTTATCTGCACTGT TAATATGGCGAGATATTGAATGAGTGTATTTCTCATAATGAGATTATGTGGTAGAAGGACACATACATAATATGAATTTT TGATCATTTTCGTTAAGTCTAAAAAATTCTAAATGAGTCTATCGATGGTCATATATAGAATGATCTTAATCATGAGTTCT TAACAAACAACTATTTATGGATTTGTGTTTTTTTATTTACTCGGTACGGATTCTGAGATCCTGAATCATTTTTCTTATAT TTTGGAGACATGATGAAGTAGGTAGCTGGGAATATTATTATACGAGATGGAATCCATTCCTTCTTGAGAAAGAAGTAGAT AAATAATTCTCTTAAGGGTTGATTCGGTACTTGGACCAGTAGGTGCTCGATTCATGAATTTGTTTTATGAATCACTGTCC ATTAGAGAATCAATGGTACTCAAGGATAAAGATGTAATTAGAGAGGTTAACATATTTCACCTAGCTCTAATTATGTATTA TTTATGGAGTATTGGTCTATATGTAGTGACTAATTATAATTATGAGCGTGCAATTCTAAGTTTATAGTGGAGTAACTATT GGAATTAATAAGATTAATTATTAATTTGATTGGAGCTCGAAATTATAGGTTCGTGAGTTCCTGCGTCGTTTTTGTAATCC TACAAGACACTAAGGGTAAAATAGAAATTTTAGAATTATAGAATTCTAAAATTAAACACTCAAGGATAATTAATTGAGAA TTTATTATTATTTAAATAATGTGATTATTTAAATTTAAATTTAAATTTTAGATCACTTATATAAAGGTGTTCACATAGTG TGTGAATGTGACAACTCTATAAAATAAAGTTATTTTCCCTTTTACTTACTTTTAAAATTTAGCTTCGTTCTTGAGATTTT TCTTCGTTTTTATTTTATTTTTAATTTAGTTTCATGTTATTTGAGTTTGTTTCATTGTATCTTATTTGAGCTTATTTTAT TTTAATTTTATTTGGTTTCCCTTCCAATAATTTTATTAATCCTTAATTGTGTTTAAATTAGATGAGAAGTACAATTTGGA GTTGAGTTGGCATTGAAAATACTTCAAAAATCAAAAGCAAATCTGCATTCAGCCTTCTTCCGCGCGCCCCTGCCACTCGT GCTCTTCACTGGCCGTCCAATTGTCTTCATCTGCAATCCAAAGTGCACCATCATCTAATTTAACTCCAACCCACTCAAAG TTTGCCATGTGCCCACCTTTGCATCAGAGTCCTAATGCCCCCTCCTTCTTTTGTGCATCTGACGTGTGATTTGGTGGCTA TTAATAGCCTTGGCAGCCGCATATATATCAAAGAGGAGGAGGACCCCCTGCGCTGTCATCTACAAGCACACCCCAAAATT ATACAGAGCCCGTTGGAAGAACTGAGAGAAAAAATATTTGGGGATTTCTTTTGGAGAATTTAGGGTCACTCTTTTAGGAT TTTTATATTTAGTTTTAGGTTTTGTAAGGGAGAAAATATTTTGAAGATCAAGAATTGAAAATTGAGGATTTAAGAGTTAA GTTTGGAACCTGTGACACTTTTATATGAATTTTTTCTTCTAATTTTTTTATCTTTGTATTTTTATGAATTGAGATGTTGA GACCCTTGATTTCTTTTATTTTTATTTTTATGTTCTAATTTTCTTTTTCCAGGGCTATGAGATTACTAATTCTATTTTGA TTTAATTTCATTTATTTTTACTTTCAATGAATTAATTCACTAAGAGTTTATTGTTCATGATTGTTGTTTCTTTCTCTATG ATTAATGCTTTCAATTATCTGGCCAATATTTGAATTATTTTGGAGACCTAGATTGAAACCCCAGAAGGAGATTTTTAAGA ATAGCTTCTTGTGAGAGAAATCGTAAGGTGCATGCGACATCTAACGATAGTAACATGACTTGCGTAAACAATTAAGAGAA CCATAAAGCGTAGTGAATTTCTAGGGTGGTGGAATTTACATCAAGAGATAATGGGTTTACATGCTTGGAATTTATTTGAT AGCATCCCCAGAAGGACTATTAAATCATTTAGGGTTACTCGTTCTAACACATGAATAATAAACAATGTTAGTAAGAATAA TGAATTAAAGAAAATTAGATTTTGTGAATCAGTTGCCCTAGTCTTTAATTTGTTTAAGTCTTTTGTTTATTTTAGTTTCA TTTATTTGAGTTTTTATTTGTATTTTATTCTTACTATTTTTTCTATTTTATTTTACACTATTCAAATAATTTTATAGTTA AGTAATTTCGGTACTTAAATAAAATTAATACAATCCTCATGGGAAAGATACTTTATTCACTACTTTATTACTTGTATGCG ATATTGTGTACTTGTAATTTTCACATCAAGTTTTTAGCGCCGTTGCCGGAGATTGTTGTTTAATCTTGATTAATATCGAT ACTAATTAGCTCTAGGATTAATTTGAATTTTTTTTTCTAATTTTCCTTTTCGGGGTTTTTTTTTTCTTTTGCAGGCAAAA AAAAAATAAAAAAATAAAAAAAAAATGATGACTAGTTATAGATGGACCGAGCCATCATCACTCTCGCTCAACACAATACT TAATCGCTTCATCGAGCTTGGGAGAGATATAATGAGTTATTGACTTGGTTTCCGCAACATGGTATTCTAAAGTGGCTTCA ACTTTAAATTTTCATTAAAGGATTAAGCATAGCGACCAAAAGTTGGGTTGAAAATGGCTATGGTATAACCCCATTCAGTG AAAAACCTAAGGATGAAGTCTACCAAATGATGGATGATATGGTGATGTGTTATCAAGATTGGTACATTCTAGAGAAGTTG TCAAGGGAATTCAAGCCTCTAAAGGAAGTTGAGCCTCAAGAAGAAGAACAAGAACCCTTCAAATCTATTTTTGCTCAGAC CTTAGCACAGTTAGACTCTCGTGGTGTCGACACCGATTTGTTAAGTAATGAGGTGTCCATCCAAGGCCATGAGTTTTATG AAGATCAAATTGCATGCATGGCTGTGGATAGCGAAGTTGAGAGTGAAGAGAAATTGGAGGGATTATTTGAGGATTTCCTA GATGAAGAAGAGGTACGAGAACCGTTGGAGGATGAAGAAGCATACGAGAACTGTTGGAGGATGAAGAAGCATACAAGACC ATTAAATTGAGCTCATTCGTGGTCTTATCATACACACCAACAATGAATCCTTACTTCTTTACAATGCCACCATCACCATA TTATGTCCTCTACATGATCGAGCCTAAAGAGAAGTTCTCCACCTAAGCTCATAATCAATTGAAGCAAATTCGTGTTAGAA CAATGAGCTGAATACTTCCAAATCATGCCAAGCTTGCAGGCATCCATAATCTAGACCAATATATCGTGTTGATGACACTT ATTATGGGCGAAAGCCGCTCTTTGACGAGTACTTCTCCAAACGTCTGGCTGAAGACATTAAAACAAGCACTTCTTTCGAG GCAACCCAAGTTTTCTAGAACTTTTCTTGTTTTGTTTGAGTTTTTAGGCTTTAGGAACTTTTTTCTTTGTTTTGTAGGTA CAAGCGGTGGAGCTAACGAAAGGCGGTGCAAATTCAAGGAAGCTATCATGCACCAAGCCTAAGCACCAAAAAAGGGGAGT TTCTTAAACTTTTCCTTATTGTCTTGACTACTTACACTTTTGAGGATGATGTGCATCTAAAGCTTAGAGGGTGAAACGTT TCTTTGTTTTAAAAAAAAACAAAAAAAAAGAAAATTTAAAAAAAAGTTTTTCTTTATTTTAGATAAATTGAGATGATTTG TGCTTTCTTTGGTGATTTTTCTTGTTCCGATGATGAGACTATGGTTAATAATTTTATAGCTTTTCGAAAAGTGTGAATTT TGTCTAGTATGTATTTAATTTTTAGAGTGAGTTTTATTTTGATCGTAATTGTTCCATATTTAAACATTATGCCTTGATCT TTGAATTGCATGTTGATTTAGAGAATGTTTATGTGAATATGTGATTTTTCTTAATCTCAAAAGTCCTATAATTTGTTTGC TTTTCTCTTGAGGCGAAATCCTAGACTTTATATTACCAAGGAAATGATTTAGGCCGTCTTTAGACCGTTTGAGCCTTTCG AGCCTACCATGACATATTTTTATCCCTAGCATACCCCATTGAGCGTAATGTCACATTTTCTTTGTTATCCACATCTTTAG CCTAGCCTTTTGAATAACAGTCAAGTTTTTGTCTATCACCCCATAAGCATGGTTGTCACTTTAAAGAAAAGATTTTGAGC TATGCAAAATAAGGGAGGAAGGGTGGAGTTTTAAAATTTCAGTGTGCTTGAAGTGCAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAACAAACGTAAAAGAAGAAGCCAAGGCCGCAGCGCCCACTGACCAAGGCCACGGCACTGGTGGGCC GAATTAATGGGCGCCGCAGAGCTAGAAAGCCAAGGCCGCAGCCCTAAACCAAAAAAAAAAGCTCAACGCTTCGGGGCACT TTTTTTGGTTAGGGATGTAGTTTCCTCCATGTTCTTGTTTTTTTCACAACATTGAGGACAATGTTGATTTTAAATTTGGG GGTAGGAGGCGATCGAAAAAAAAGAAGAAAAATTGGGTTGACAAAAATAAAGTTAAAAATAAATGTAGAAATATTACTTG AAAGGGAGAATTGTGTTCTATTAAAGTCTTAGGCCCCGTTCATTTCGCTGATTCGAGTTTAGAATTTGAGTTTTTCTACA GTAAAAAGCTCTCATAAACAATCACATCTAACTTTTTGCTACGGTAAAAAGCTCTTACATAAAGTCACATCTCAACTCGA ATTAAAAACTCGAATCAGCGAACTAAACGGGCCCTTAAAGTGATTAATGCGCTTTGAAGAGTGATTTGAGCAAAAAAAAA AAATCTATATGCTACCTTTACCCAAACCACACATTATAAGTTAAATAAAGTCTTAGTGGACGTTTAGTTCGTGTATTCAG AATTATTCTTATTTTACATGTGTTTTTTGTGAGAAAAAAATACTGTAGAGAATCATAAATTATAATTCAGAATTAAGAAT GAATACTGAAAATAAGCGGGCTCTTAATAATTTTTAATAATATGTTAATTTATATTAGTGGAGAGAGAAATAATCGCTAG GGCTTCCCTCATGCGCTCCAACACGCGCTCAAAGCCATCAGATTGCTTCTCCATTCCAGCCATTTACACTTTGCTTATGA GAGCCCTAAGGATTTGGAATTTCCTTTGCTGACGTGTGAATGAGGAAGGCTTTATAAAGCTTTGGCGGCCGCGTATAAAA AAGAAAGAAGATCCCTGCTGCCCTGTACGTTGACGATTTCATCGCACCACACGTCTATGCATCCTCCCTCACACGCGTTA CCACGTAGCCAACTTAGCTCTTTCCATTGACAAAATGACACGTGGAAAGCAATAGCAGCCCTACTTTTGGCTGCTCATTC CGTTTGGCTAACGAGAGACTTTGAGAGGCTTTATGAAAGCTTTCAGCCACAACATGAAAAGGAGGAGAACGCCCTGCAAT TATTTCACAGAGCAAAACACCCAAAAACAAAAAAAGTCCCGTGGGAAGGGCTGAGAGAAAATATTAGGCGAAATTTATTT TTGGAGAATTTGAGGTCACTTCATTAGGATTTTTATTTTTAGTTTTAGGTTTTATAAAGGAGAAAATATTTTGAAGATCA AGAATTAAAGATTGAGGATTGAAGAGTCAAGTCTGGAGCTTGTAATACTTCTATATGAGTTGTTTTTTCTAATTTTTTTA TCTATGTATTTTTGTGAATTGAGATGTTAGAACCCTTGATTTATTTTAGTTTTATTTTTATGTTCTAATTTCTTTTTCTA GGGCTATGAGATTACTAATTCTATTTTGTTTTAATTTCATTTATTTTTGCTTTCAATGAATTAATTTACTAAGAGTTTAT TGTTCATGATTGTTGTTTCTTTCTCTATGCTTAATGCTTTCAATTATATGGCCAATATTTGAATTATTTTGGAGACCTAG ATTGAAACTTCAGTAGGAGATTTTTAGTAATAGCTTCTTCTGAGAGAAATCGTAAAGTGCGTGCGACATCTAGTGATAGT AACATGATTTGCGTGAACAATTAAGAGAACCATAAAGCGTAATGAATTTCTAAGGTGGTGGAATTCACATCGAGAGATAG TGAGTTTACATGTTAGGAATATATTTGATACCATCCCTAGAAAGACTATTAAATAATTTAGGGTTACTTGTTCTAACACA TGAATAATAGGCAATGCTAGTAAGAATAATGAATTAAAGAAGATTAGATTTGGTGAAATCAGTTGCCCCAGTCTTTAATT TGTTTTAGTCTTTTATTTATTTTAGTTTTGTTTATTTGAGTTTTTATTTTTATTTTGTTCTTACTATTTTTCTATTTTAT TTTAGGCTATTTAAATAATTTTAGAGTTAACCAATTTCGGTACTTAATTAAAATTAACACAATCCTCATGGGAATAATAC TTTATTCACTACTTATTACTTGTATGTGATATTGTACACTTGCAATTTTCACATCAAAAGGCAAGGCACAGTACGAACAC ATAGTGTGAACACATGTAGAATTATCAATTTAATTTATTTGATAAATTATTCAATTTAGAATTCATATTAATTTGAGTTT GACTTAAATTGGAATTTGTATTTGAGTCAAATTGGACTGCTAAATAAATGATGATTTTCTCTTCCTTCTCTATATAGTGT TGGCGCATACCACAGGGATAAGATTTCCTATCTTGGCTGGCCACAATGGATGGATAAGGATGGGAGATTTTCTTCAAAAT CAAATTTAAAAGTGGGAGAAAATATATAAGTTTTATCTTAGAGATAAAGGCTAGACTCCTTCTAGGAATATAACTACTAA TCTATAAATAAGGAGATAGTATAAAATTGTGGGACACAATTTGTTTTGCTCTTATTTTTCTATAGTGGTCGCTTTTCACA AGTGTTGTGAGAGGAAAAAATTTTTCCAAAAATTCCACGTCGCATGTGTTGGTGTATGTGAAAATTCTTGAGTGTTTTTG TTAACTCTTTTTGTTTCAGGTGTGCCCACACACACATCTTTGTGGATTCAAGGAATTGACAAGGAAGGCTCGGGTTTTCT AAACAAGCTTTGGTGTTCTTGGAGTGAGGAACGTTCATGGTCAAAGAACTCAAGTTATCATCCTAATCGGTTGCTAGGTA TAATTCCTAATCCGGTTCTTGATAAATAAATTAATATGATTAATTTATTCGTGCATAAATTAATATAATCTATAGAGTAT CTTAAAGGTTTTATGAAAATTTTTGTCATACATGATCCGCTACTCTCACGCTTCCGCATCCGAATTCTATTCGGAAACCA ACAATTGGTATCATAACGGTCTATAGACGATATTAATTTATGCTCTGATTTTTTTATAATCAAAATTAATATATTAAATA TGTGATATTTAATTATTATGTATGTGATGGGTAGGCACTTTCATTTATGGATGCTTATATTTATTCATGTTGATGAATGT ATGGATGATGGATTTGGTCGTGAATTATATGGTTCCATGGATCGCATTAAATTCGTTCAATTAAAATTATTTGTAATTTT ATTTGGGAATTAGAATTATTATGGGCCTGTTTAGTTCGCTGATTCGACATTTTAATTCAAGTTGAGATGTGACTTTATGT GAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGATTTTTTCTGAGAGCTTTTTACTGTAGCAAAACTCGAATCGGTGA AATGAACGGGACCTATAACTTTAGGATTTGGGCAAAATTAGAGTTTTGATTTTGAATCAAAAGAAGCCCGAAAGATTGTT TTAGCTGCTGCCGAACCGAACCCCAAAAACTACCCAGAGACAGCCCCCGAATTGTTGCCCGGACGCCCAGCCACAGGCCC AGGGCGTGCCCCGCGCCCGCCCAGTGTGCAGACAGCAGGCAAAGCGCGCCCAGGCGCACACAGCGCGTACCCAGGCACGC GGCCAACGGGCTATGAACGTGCCCGAGGGTTTCCAAAACCCTCCTTTTGCGTGCTAAAGGACCCGGAAGAGTTCTAGACC CGAAGAAGGTGAAATCCAAGCCGAAGATGAAGAACGAAGCCGATGAACAAAGAATCTAAGAGCCGTTGATGTAACGGATG AAAATAATTATTGTAATTATTTGTTTGTTCGATTTTGTTGTAATTATTATTCGTTCAATATGGTTGTAATTTATATATTT TTCATGGGACCCGGTCAAATTCCATCTCAATAGCCGATTGCATATTTTGTACTTATATTTATTTGATGATTGTATATTAT ATGTCCATGCATATAATATGCCATATAGATATAGTGTGCCTACTCATATGTTTTATAACATGCCATGTATATACGCGCAT TTAATATTATCTATTTTATTTGTTATAAAAGAGTTTTAGAAAAATAAAATAAAATAATAACCATGTGCTAAAATTGATTT AATATGATTAAATTGATTTAAGTTGCAAAATTGATTTGCAAAATAATGTTATAAGTTAAGTTGAATTTAAGAGTTAAATT TTAGAATTTCACATATCCGAAAAATAAATTGTTTATTTATCAGGATTTAAAAAATATGAGATGATTTTCAAATAAAATAC ATATTGGCAAAATAATGAGTGGGAGAGGGTTGTGTGACAATACGACCCACTGGTCTCTATCGTTAGTTCAGCACCGTGAG ATTCAAAAGGAGCTTCTGACGGCGCCGATTCCGCACTCCCTACGGAAAGTGTTCTTTTGGGTCAATAACAAGGTTGACTT CCTAGCCATAGGATTCAAAGATGTGTTTTTGGTTTGACCTACCCTATGGTGGCACTTCGGAGTTAAGTCCGTAGAATCTG AAACGATGGGTTACACTCATAAAAATATAATCAAATTTGTTGATTGTATTTTTTACAAAAATAATGGTAGTTGATAAATA TGAAAATAAGAGATATTTTGATTATATTTATTAATTGAGAAGGTCTCGGTTTAATTTATGATATTTTGACCTACCCCACG GCGGCACTATATTCGTGGTAAATTAGATTATCGTTAGCACCAAAATTAAAACATGGTTTATGTATTTTTCACGTGCATTA TGCATCATATTTAATTGTGCTTAAATTCACATGTTTTGATATTCATGCACATAAATTGATTAGATAAATATTATACTTAT TTTCAGCAATATGTCAAATCCTATAATTTCACAACATGAAACTGAAACACTGACTAGAGATAAACTATGTGAAGTAGTAA AGTAATGTAAACGACTTACATTCATGTGATTAATATAAGTTTGTGACAAATGGAGGATTGTCCTCTTGTCCCTAACGAAA CCATTGTAGCTAACTGTTAACAAGAAACATTAAGGCATGGAGACATCTTATGTGATAAAGCAGTCATAAGATACCGTATA TAGAAATCCATATGAAGGGCTTGGCTAAATACTGTAAGGGCCCTGACCAAAAGACAAAGGGAAAGTCGTTTCCACCAAAA TAAAGGAAAAGAATCAAGCAAATACGATTTGCTAGTTCTGAAAACATGTTTAGTAAAGGGTGATTCTTATTCCTAGATAA TAGATTCGAGAGTAACTAATCATGTTTGTTTTCTTTATTAAGTCTTGGCTCTCACAAGGAAAGTTGTTTCCGCTAAAATA AAGGAAAGACTCGAGCAAATTTGATTTGCTAGTTCTAAAAACATGTTTAGTAAGAGGGTGATTCCTATTCCTGGATAGTA GATTCGAGAGTAACTAATCATATTTGTTTTCTTTATTAGGTCTTAGCTCTTACAAGGAAATTATTTTCTGAAACAAAAAA AGGAACCCAAGTAAATATAATTTGCTTGTTCTATGAACATGTTTAGAAGAGGGTGATTCCTAATCCTGAATAATAGATTC AGGAACTAATCGTGTTCGTTTTCATTGCAAGGCTTTAGCTCTTAAATGGAAATTATTTCCACCTAAACAAAGAAGTAGAA TCAAAGTAAATAAGATTTACTATTTCTATAAACATCTTTAGTAAGAGGGTGATTCCTCGTCCTGGATAGTTTATTGGGGA GCAAATAATCATGTTTAGTTTTCTTTGAGAATACCGCGAGGGTATCGGCAAAAGCAGTGGGAGAAGTTAGACTTCAATTT TGAAAATAACCTTATTGTGAACAATGTTTATTTCCCTCCAAGGGTAAAGAGAAATTTGATTTCTATTTTTAAATTATTTG AACAATTTAATATAGTCCATAATTTTTTAGAATGGTTCCAATATTTGTTCTGGATATTTGGAAAATGTTTTATATTTTAA ACTGATGCCTGACTCACTATTTAATGTTGAAATATTCAAAAGTGGCCAAACCTAAGAATAAGAAGCAAAAGATCTATCAC GACAAGAACACATATTTGTGGCATCTTAGGCTTGTTCGTATTAACCTAAATAGGATTGAAAGAAAGGTAAAGGTTGGTCC TTTACGCGAACTAAAAGTTAGCGAGCTTCCGGTCTGTGAATCTTGTCTCGAAGGTAAAATGACCAAGAGGCCTTTCACGT CAAAAGGAGATAGAACCACAAAACCACCTCGGCTGATATCTTTGGATGTATGTGGACTGTTAAACGTCTAAGCTAGAGGG GGTTACAAATATTTCATCACCTTTATTAACAATTATTCGAGATATAGTTATGTTTACCTAATGCAACAGAAATCTAAAAC TTTTAGAAAGTTCAGATAATTCTGAGCAAAAATTGAAAAACAAATAGGTAAATTAATCAAGACACTCTGATTACTTGATT AAAGCAGGTGTGTTGTCACAATTGACAGCCCCGAGCACACCACAGCAGAATGGTGTTGCCGAAAGGAGAAATCAGACTTT TTTTGACATGATAAGATCAATGTTGAGTTATTCTTTATAGCCTACTTTGTTCTGGGGTTATGCCCTAAGAACCGCCTTGT ATACTCTGAATCTAGTACCATCTAAGTCTGTACCAAGATGCCCCTAGAGTTATGGAGTGGTCGAAAGCCAGTTTTGAAGC ATATTCGCATATGGGGGTGTCCGGCTCATGTGATGAAATAAAAGACTGGGAAATTGGAACCATAATCAAAAGTATGTATA TTTGTGGGATATGCCCCAGGGATGAGAAGAGGATTATTCTACAGTCACAATAATCAAAAGGCATTTGTATCGACAAATGC TACGTTTCTAGAGCGATTTTAAAAAAGTTACTTTCCAATGAAATTGGACCACAACCGACAAGAGTTGTTGGAACGCTAAG AGATAAGACAACGATTCCTAATCAAACTCCTGTGGGACCTCATCGTAGTGGGGGGGGTAAGCAAGTTACCTTACCGGTAT ACCGGGGAATCCCATATCGTCACCACTGATGAAGGTAAGGAGGATCCGTCAACCTTTAAGGCTGCAATGGATAACTGATA AGGAAAAATGGTAAGCAGCTATGAAACTCGAGATGGAGTCCATGTACTCTAACTCAGTCTGGCAACTTGTAAATCAACCT GAAGGGGTAAAACCCATTGGATGCAAGTGGATTTTCAAGAGAAAGAGGGGAGTGGATGGAAAAGTAGAGACTTATAAAAG CAAGGCTAGTGGTAATGGGTTACACCTAGAAATAAGGAGTTGACTATGAGGAAACTCTCTCACCGGAAGCCATGCTTAAA TCTAGCCAGATACTCTTGGCCATAGCAACATATTTTGAATATGAAATATGACAGATGGATGTCAGGACAGCTTTCTTGAA TGGCTATCTTGAGAAAACTACCTATATCGATCAGCCAAAGGGTTACATAGAGAAAGGCCAAGAGCAGAAAGTCTGCAAGC GATAAAAATCCATTTATGAATTGAAGTAGGCGTCTAGATTATGGAACATCAGGTTTGATGAGGCTATTAAGTCTTATGGA TTTGATCAAAACCAAGATGTGTCAAACGAAAGAAAAGAATATGTTCTTGTTCTTTACTAGCTCGAATATGTAATATTTAA TGGGAGTGGTCAGTCGTTGTTAGTTGAACTCAAGATTCGATCATTGGGTAGGGTGTAATGTATCCTTAAGTTTATGAAGA AAGCAAGAAACTGTAAGAGTTAATGAATGAAGTTGTCTTTTAGCTGGATACACAGACTTTGACTATGAGTCATGCATGGA TATCGAGAGTCGACATCCAAAACTATGTTCACACTAGGTTAAGGAGTCATGATACTAAAGGTTGTTGGCAAAGTGTGATT GCTAATTCTATTATTAAAAGTTAATGTATTGCCGCTTGTGAAGCAGAAAAAGAAAGCAACCTGACTCCAGAAATTCTTAA CAGATTTGAAAGTTGTTCCAGGCATAGATCAACCATAGACACCTAGAAAGTTTCAGGATTATAGACATATTCTACCTACT TTAGGACAAGTGGGAGATTTTTGGGAATGGTGTCCTAAAAGCATGAGATGTAATAGGATATTTATTATTTATTTAATAAA AGAGTTTATTCATTATTTTATGTGCATATATTTATGAATATTTTTATGAATATCAATGAAAATTCCATGATTATTTATGC GACCTTAAAAATTGTATATAAGTGTTATATACGAGAAGATAATGTTTAAGGATAATAATCAAAATAATGTTCGTAATGAA TTTAATTAAAGCTCAGAATCTTTAATTAAAACATTATTAATACATGTCATTCCCATTTACAATGGAACGGTGTTATCTGC ACTGTTAATATGGTGAGATATTGAATAAGTGTATTTCGCATAATGAGATTATGTGGAATAGGGGCACAGACACAATATAA ATTTCTGATAATTTTCGTTAAGTATAGAAATTCTAATTGAGTCTACCGATGGTCATATATAGAATGATCTTAATCTTGAT TTCTTAGCAAACTCCAATTTATGAATTTATGTCTTTTCATTTACTTGGTACGGATTCCAAGATCCTAAATCCTATTCCTT GTATTTTAGAGATATGATAGCCGGGAATATTATTATACGAGATGAAATCCATTCCTTCTTGAGAAAGAAGTAGATAAATA ATTCTCTTAAGGGTTGATTCGGTACTTAGACCAGTAGGAGCTCCGATTCACGAATTTATTTTATGAATCACTGTCCATTA GAGAATCAATAGTACTCAAGGATAAAGATGTAATTATAGAGGTTAACGGATTTCAGCTAGCTCTAATTATGAATTATTTA TGGAAGATTGATCTATATGCAGTGACTACATCACATGGACACTTCACGATTTAGAACTAATTTATGTTAATAATTACGAG AGTGCAGTTCCAAGTTTATAGTAGAGTAACTATTAGAATATTAATAAGATTAATTAATTAATTAAATTGTTTAATTAATT ATTAATTTTATTGTAGCTCGAAGTTATAGGTTTTATGAGTCCTCGCGTCGTCCTTGTAATTCTACAAGACACTAAGGGCA AAATGAAAATTTTAGAATTATGAAATTCTAAAATTAAACACTCATGGATAATTAATTAAGAATTAATTACTATTTAAATA ATGTGATTATTTAAATTTAAATTTGAATTTTGGATCACTTATGTAAAGGTGTTCACATAGTGTGAACGCAAGGCACAGTG TGAACACATAGTGTTAACACATCTAGAATTATCCATTTAACTTATTTGATAAATTGTTCAATTTAGAATTCAAATTAATT AGAGTTTGACTTAAATTAGAATTTGAATTTGAGTCAAATTGGACTGCAGGATAAAGGATGATTTTCTCTTCCTTCTCTAT TTGGTGTTGGCGCCTACCACAGGGATAAGATTCCCTATCTTGGCCGGGCACAATGGATGGATAAGGATGAGAGATTTTGT TTCAAAATCAAATTTAAAGTGGGAGAAAATAGATAAGGTTTATCTTGTAGATAAAGGCAAGACTACGCCGTGCATGTGTT GGTGTTCGTGGAAATTCTTGAGTGTTTTTGTTAACCAGTTTTGTTTCGAGTGTGCCCACACACACGTCTTCGTGGATTCA AAGAATTGACGAGGAAGGCTCGGATTTTCTAAACAAGCTTTGGTGTTCTTAGAGTGATGAACGTTTAGGATCAAAGAACT CAAGTTATCACCTCAATCGGTTGCTAGGTATAATTCCTCATCCGGTTCTTGATAAATAAATTAATATGATTAATTTATTC ATGTATAAATTAATATAATCTATAGAGTATCACAAAAGTTTTATGAATATTTTAGTTATACACGATCCGCTACTCTCCCG CTTCTGCATCTGTATTCGATTCGGAAACCAACAATTAATGATTACATACTATCTTTAGTCCTTGGACAATTAAAATCTTA CTATTGCTATGAAATAATTATATCTTTATATGAAAACATATATGAGCTTAATCTATTATATTCTCAAGAATTTTTGCACA CCCTGGAATTTAATGGAATACCACCACATCAACTAAAACTTAAACTATGAACTCATATAATGTTACTATGAAATCTAAAT CAGTCTATTGGATTATGCAATGGAACAAGACTTATTATTACACAATCAACAAATAAAATCATAGAAGCATAAATTATAAG TTCAAACAATGCTGGTGATAAAGTCTATATTCCAAGAATAGAAATGACTATATAAGAATCTAAATGGCCATTTACATTAA AAGACGATAATTTCTCATAAAAACTTGCTATGCAATGACAATAAACAAGGGTCGGGGACAATCTTTAATTAAAATTGGAT TATATCTAAAAAGTGAAATTTTTACACACAGACAATCATACATTACCTTATCAAGAGCCACAAGCCCAAAAGGATTACAT ATATTAATTCATGATTCAATTAATAAATATCCAAATCATATAAAAACCATTGTCTACAAAGAAATTCTACACAATATTAA ATAAAAATATAAAATATTAGATAAAAATATACACATTGTGATCTCCTTTGTACGATTAAAGTATTTTATTACCGATCATC ACAAAACACATTCAACATCACATCAATAATTTCATATTATTAAAATCCTTCATTGCTAATACATTGACAACATATCTAAT AAAATTATTCATTTACATACTAAACAATTATTTCTTACTCTTAACTGTTAGACAGAATGACAACACCAATTCATGCACTA AGACTAAATGAGGTCTGTGAAGTTATCCGAGCAAGAATTTGTAGATTATGGACAAACAATGACCTCACTACAGGACGCTT AATAAGTCTCGATTGTCTCTGGGTCGATGAACAGATAATGATTTCCACAAACACTATATTAGATAATGCTTAATATAATA TAAAATGTTATGAAATCAACGACAATTTTATCTTTCCCATTTGTAGCATGAAGCAATTCAGGCATCAATTCGAGCGCGTG ATTCAGACTTTATTTCTCAAAAGATTCAGCTAAACAATATATACGATATTAGCAACTTCTTCCTCACTCAAAACAAGGCA ACATATAAAGTCGTGCGGCATAATACAATGATTTAATTTGCTCGTGCAACATCCTTTGTCCCAGTTATAGAAGAACCACC TCCAATTCCATTCTGCAAATTTTATTTCACTAAGTTCGATCAACTCCAACACAAAATCCATACAACTGAAATTTTAAGCG ATAACATTAATTACTTTCTCCAAAAAAAAAATAAAAGAACAAAGCTGTCACTAATTTATTAATGCGCATTATTTACATTT TAAATTTATTTGTCAACAGATGTCATCTGTGTACTAACAAAGCTGCAAACAATTGAGCGAACAAATATCAACAGCAGATC AACGTCGTGTCGCACTATAATGATCCAAAACATAAAGTAAATAAACTCTGTATAAATTTCATTAGAATCACATAAAAAAA AATTACATTAATTTTCCTTTTTATTTTATTTTCTCAACATAAATGAACAGCTCCAAGTTACCTTATAGGGACATAAAGCA TACCAGTTTGATGAAAATGTTGTGAAGTCAGTAAAAGAACTAGTTGTAGCAGTCTTCGCATCAATGTTGGTCAAGCAATA TCTAAGTATTTCCTCAAGAACTTATAAAAATAATTACATATAAAAATGAAATGCCTATATAAGAATATAACCAAATATCA ATTACTTTATTGTAAATATTTTAGAAAATGCATATTTTTCAAGCACCGCAACAATAATTTTTTACATTGATCCAGATATA CCATAAACAAGAACATTAAAGGCAAGGTAATACAAATAATATACAACATTTAAAAACAAAAAAAAAGCTTTTATTATTTC TTTCCTGACTACTTTTAATTTTACATGTGCATATACAGATTCTCCTACCAAAATTAAGAAATTGAATTCGCAATAGCATC AGCAACCTCAACGAAATCCATTGAAGAACAAAAAATGGATAACAGAAAACTAATTGATGAGCTAAAAACATTAGATCAAG AAAGTAATCAGGTTAGTATCATAATATTATATTCTCGCTTCTTCTCCAACTATATTATTTAGACTATCAACATTTCCTCA TCTACATAGGGCACATCATGATTTATAGTAAAGGCCACAATAACCGGATTCTCAATAGACCAAGACTGGTATTACAACTT TTACCTCAGATGTTATCGACAACTAAAGCAAGCAGGAATTTGTTGGTGGTGTGACAGTCATGGTCATATAAAAACAACAC ATTCCCCATGGTAATCAATATGACAAATACACTATTATTAAAATTTATTTGCCTCCCTGAACTATAATAAATAACTTATC ACATCAATGAATTATTGTTGTATATATTACAGGTACGGGTTGATTGTAGAAATCGAAGATCATACTGGGAACATGAATAT CACCATATTTGGTAAATTAACACAAGTCCTAATAACAATTGACGAGGGCTTTACTGATCTTTTTACAATCCCACCAGTCA TCGCCCAGCTAAAAGGACAGACAAAATCTTCCAAACATATTTTCAACAAAGAGAAGCACAAATGAATGAAATTGTTTCAA AAATATTTGAAGACATTGATCCTACAATAGCACTATCAAAACAATCAACCATCACTGCACCAATAACAAGGTACAACATA TCCTTTAATTTAAATCAATTATACATAAAAAAATGACATTTATTACTTCGAATACACATCTAAATAATATTTTACCATTT TAGCCCTCGCTCAAAAACAACAACAACAACTCCAGCCTCGATTCACCCACAGATACCAGACCCAAAAAAATCTGCTGCAA GGTAAAATGTATTTACCAATACAAAAAACAACATTCTTCATTTTAAACACATATTTTAACAATCTCTTATCATTTCAGTT TCCAACTAAAAAAAAAAAAAGCAGAGCACTCCAAAAAACGCCTAAGAACCAGGTAATATAACTACTTCTAAATGAAAATA TTTCAAATTTCCTCAATCATAAATGCTAATTTTTCTCAAAATTTCTGCCTTGCAACTAAAAGAAAAAAACCTGAAAAAAA AAAAAGCAAGGACAAGACATCAACAACATTGCAAGTAACTTTTTACAATAACATTATGTAAATATGTACATATAAACTAA CTATGTATTATAAACATTGTCACTTCCCTGTATAGTATAAAATTATAGCCCGCGGCAATGCGTCGGCATATAGCTAG