>DTT_1_1_Mno Class=DNA transposons;Order=TIR;superfamily=TcMar;length=811; ACCTCTATAAANTAATATTGTTGGGACTAAAAAAAATATTATTTTAANGAGATTATTATTTATCGATAAATGAATAATTT ATTAATTTATCGATAAATGAATAATTTATTAATTTAAGAAGAGTTTTATATTTTAATAACTTTCGTACATGTACTTTTTC TTTTACCAAGATTCATGTATGAGTTATAAATAAAAAAAATAGTGGTATGTAGTCAAAAATTAATATGTTTACATATAGAA TTTCAAAAGTTATCATGTCATATAATAAAAGTTATATATATGCAGTACATAGAAGCCTAAAATTAATGTAAGTACATTGT ACATAGAATGTTAATAAGTACATATAGACATAAAATTGATCATGATTCAGATGACAATTGTATTTTATCGAATGTTTCTC CAAAAGAGGCGTTTCAAGCAATAGTAACCTTAAATAACTACTTGCTACAACATGAAAAAAATATACCAGATGTNGTGCAT GCTTTGTAAAAAATTAAAGACGAGGTTGAGTTCAATTTAGGTACAAAGAAAAAACAAATGACTTTAGATGCATATTTTGT AAAAGAGTTGAATTGAGAAAATAGAAGTTGTCAAGAAAAAAACTCTTTAATATNATGAATTNTATATGTTTTTGTTAATT ATTAATTTATATTTTCGTTGGGCCCTAAAGGATTTGAAAAAAAAATTATTATCTTATGCATTTAGCGAGATTATTAATTT AGTACATTGGCCCGAGTCGGGACCGAAAGATTTTATTATTTAATCGAGGTTATTAATTTATCGAACATTCATTTATCGAG ATTTTACTGTA