>DTA_1N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=640; TAGGGCTGTTCATAAACCCGCAAAACCCGCAGGCCCAACCCACCTCACCCCAACCCAACCCGAAAAATGTAATTTTTAGT ATTAAATTTTTTTTTCGGCCCATTCAATGTCTGGCCCGAAGTTTTGGGGCGGGGTGTGGGTTGGGCCTATAATGGCCCGC ACACCCCAACCCAACCCGCGCTCTAACTTGCCTCCTCTAATATCTAACCCTAGGCAGGCAACTCATTTCTACTCTCTAGT TTCTTCATGTTTGAATTAAGCCTCTATGTTTGCTTTATGTTAAGACTAATTTATGAGTGTAGACTAATTTATGTTTGCTT TATGTTTGATGTTGGATGGACTACTTTGCTTCATGTTTGATGTTGGATTGAACTTTGAATTTCTATCTGTTTGAATGTTG GAGTTATTATTTCTATTTGATGATGAACTTTGAATGTTGGATTGAACTTTGAGTCTTTGATTCTTTGAATGTTGAAACCG ACCACCCAACCCACCCCGCACCGCCCCAACCCAACCCAAACATCATTGGGTTGTGAAATTTTTCTAACATCGTTGGGGCC AAATATGTGCAACCCGCACCCTTTGGGGCGGGAGAAGAAAAAGTCCTACCCCGCACCAACCCAACCCATGAACAGCCCTA >DTA_1N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=706; TAGGGCTGTTCATGGGTTGGGTTGGTGCGGGGTAGGATTTTTTTTCCCCGCCCCATAGGGTGCGGGTTACACATATTTAG CCCCAACGATGTTAGAATTTTTTCACAACCCAACGATGTTCGGGTTGGGTTGGGGCGGTGCGGGGTGGGTTGGGTGGTCG GTTTCAACATTCAAAAAATTAAAGACTTAAAGTTCAATCTAACATTCAAAGTTCATAATCAAATAGAAATAGCAACCATT CTTATGAGTCCATCTAACATCAAACATGTAGCAAAGCAGTCCATCCAACATCAAATATAAAGCAAACATAAATTAGTCTA CACTCATAAATTAGTCTTAACATAAAGCAAACATAGATGCTTAATTCAAATCCATCTAAAGCAAGCATTGCAACAGCAAC AATCCTTATCAGTCCACACCCATAGGCTCCTCAATGGTTGTAGTAGGACATGAAGTTGAGTTATCTACAAGAGAAATGAA AATAGCTTAAGTAATAATTTGGATAGTTAGTTTAGACATGTGTTGTGCGGGTTGGGTTGGGGTTGCGGGTTGTTATGGGC CCAACCCACAACCCGCCCCAAACACTTCGGGCCAGAGGTATAATGGGCCGAAAATTAAAAAATAATGCTGCGGGTTACTT TTTTCGGGTTGGGTTGGGGCGGTGCGGGGTGGGTTTGCGGGTTGTTCGGGTTTATGAACACCCCTA >DTA_1N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=826; GGGCTGTTCATAAACCCGAACAACCCGCAAACCCAACCCACCCCGCCCCAACCCAAGCCGAAAAAAGCAACCCGCAGCAT TATTTTTAAATTTTCGGCCCATTATACCTCTGGCCCGAAGTGTTTGGGGCGGATTGCGGGTTGGGCCCATAACAACCCGC AATCCCCAACCCAACCCGCACAACATACCTCCAAGCTTTCGGCCTAAGCCCAACCTGCCCAAGTTCTACCCTGGCTCCTG ACATTAGGTAAGACAATAATTTGTATGTATCTTAATCTATTTTATTATATGAACTCTAAACTATCCAAATTATTACTTAA GCTATTTTCATTTCTCTTGTAGATAACTCAACTTCATGTCCTACTACAACCATTGAGGAGCCTATGAGTGTGGATTGATA AAGATGGTTGATGTTGCAATGCTTGCTTTGGATGGATTTGAATTAAGATTTAAGCATCTATGTTTGCTTTGTTAAGCATT TTTTTATGTTAAGACTAATTTATAAGTGTAGACTAATTTATGTTTGCTTTGTATTTGATGTTGGATGGACTATTTTGCTT CATGTTTGATGTTAGATGGACTCATAAAGATGGTTGCTATTTCTATTTAATGATGAAATTTGAATATTATATTGAACTTT AAGTCTTTAATTTTTTGAATGTTGAAACCGACCACCCAACCCACCCCGCACCGCCCCAACCCAACCCGAACATCGTTGGG TTGTGAAATTTTTCTAACATCGTTGGGGCTAAATATGTGCAACCCGCACCCTTTGGGGCGGGAAAAAAAAATCCTACCCC GCACCAACCCAACCCATGAACAGCCC >DTA_1N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=670; TAGGGCTGTTCATGGGTTGGGTTGGTGCGGGGTAGGACTTTTTTTTCCCCGCCCCAAAGGGTGCGGGTTGCACATATTTG GCCCCAACGATGTTAGAAAAATTTCACAACCCAACGATGTTCGGGTTGGGTTGGGGCGGTGCGGGGTGGGTTGGGTGGTC GGTTTCAACATTCAAAAAATCAAAGACTTAAAGTTCAATATAATATTCAAACTTCATCATTAAATAGAAATAGCAACCAT CCTTATCAGTCCGGCGAGAGAGCACCGGAGAAAGTGGGCAAGACGGCGGCCGAGAGGACTGAGCAATGAGGAGAGAGTTA TGAGGGGGTTCACGGGAGGGGAAGAAGAGGGAAAACTGAAAAGGAAGAGGCAAGAAGAGGGGGTTCACGGGAGGGGAGAC CGAGAATGAGATTGTGAACCCTAATGTTAGCGAGCCTAGGGTAGAACTTGGGCAGTTCGGCTTGGGCCGAAAGCTTGGGG GTATGTTGTGCGGGTTGGGTTGGGGATTGCGGGTTGTTATGGGCCCAACCCGCAATCCGCCCCAAACACTTCGGGCCAGA GGTATAATGAGCCGCAAATTTAAAAATAATGCTGCGGGTTGCTTTTTTCGGCTTGGGTTGGGGCGGGGTGGGTTGGGTTT GCGGGTTGTTCGGGTTTATGAACAGCCCTA >DTA_1N_5_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=597; TAGGGCTGTACATGGGTTGGGTTGGTGCGGGGTAGGATTTTTTCTTGTCCCGCCCCAAAGGGTGCGGGTTGCACATATTT GGCCCCAACGATGTTAAAAAAATTTCACAACCCAATGATGTTTGGGTTGGGTTGGGGCGGGGCGGGGTGGGTTAGGTGGT CGGGCTCATCATTCAAAGAATCAAAGTTCAATCCAGAGGCGGAGAGAGCCAAGAGGAGAGGCGGAGAGGCAGAGAGCGAG AGGAGAGGCGGAAAGAAGCCGCCGGCGCTGGAGAGCTTAAGGATCTAGGTCGACTGGTCGAGGAAGGACTGAAGACAGTC TGTGTCTGCGTGTGGAGAGGAGAGTTGCTAGACGAGAGAGAGTAGAGCCTAGGGTTAGAACTTAGAACTTAGAGGACATG GCCCATGCATGTTTGTGCGGGTTGGGTTGGGGTATGCAGGTTATTATAGGCCCAACCCACAAACCGCCCCAAACACCTCG GGCCAGACATTTAGTGGGCCAAAAAATAAAAAATAATGTTACAAGTTGCCTTTTTCGGGTTGGGTTGGGGTGAGGTGAGT TGGGTTTGCGAGTTGTTCGGGTTTATGTACAACCCTA >DTH_1N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=165; GGCCTCGTTCATTTCACCGATTCGAGTTTTCAATTTCAATTTTGCTACAGTTAAAAGCTCTCACAAAAAGTCACATCTAA CTTTTTCTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCAAATTAAAAACTCGAATCAACGAACTGAACG AGGCC >DTH_1N_10_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=223; TAAGGCCTCGTTCATTTCACTGATTCGAGTTTAGAATTTGAGTTTTGTTACAGTAAAAAGCTCTCACAAACAATCACATT TAGGCCTCGTTCACTTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCA AAAAAGTTAGATGTGACTGTTTGTGAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAACTC >DTH_1N_11_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=170; CCGATTCGAGTTTAGAATTTGAGTTTTGTTACAGTAAAAAGCTCTCAGAAACAGTCACATCTAACTTTTTTGCTACAGTA AAAAGCTCTCACATAAAATCACATCTCAACTCGAATTACAAACTCGAATCAGCGAAGTGAACGGGCCCTAAATTTTTTTT TTTAAATAAC >DTH_1N_12_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=206; CGTTTAGTTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAAGT TAGATGTGACTGTTTCTGAGAGCTTTTTACTGTAGCAAAACTCGAATCGGTGAAATGAACGGGGCCTAAATATATTTTTA TTAGAATTTAAATTTTAATATATATTTAATAACTTAAATGGTTTTT >DTH_1N_13_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=303; CGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGTAAAAAAGTTAGATGTGACTGTTTCT GAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAACTCGAATCAGTGAAATGAACGGGGCCTTAATTTAATTAAATTAA AAAGGCCCCGTTCATTTCACCGATTCGAGTTTTGCTACAGTAAAAAGCTCTCAGAAACAGTCACATCTAACTTTTTTGCT ACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATCAACGAAC >DTH_1N_14_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=146; CGCTGATTCGAGTTTTAATTCGAGTTGAGATGTGATTTTGTGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGAC TGTTTCTGAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAACTCGAATCAGCGAAATGAACGGG >DTH_1N_15_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=251; ATTTGAGTTGAGATGTGACTTTATGTGAGAGTTTTTTACTGTAGCAAAAAAGTTAGATGTGACTGTTTCTGAGAGCTTTT TACTGTAGAAATAATAAACTCGAATCGTAAATAACGTTATTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTT TATGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGACTGTTTCTGAGAGCTTTTTACTGTAGTAAAACTCAAATT CTAAACTCGAA >DTH_1N_16_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=136; CCCGTTCACTTCGCTGATTCGAGTTTGTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAA GTTAGATGTGATTGTTTGTGAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAAC >DTH_1N_17_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=126; TTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAAAGCTCTCACAAACAATCACATCTAACTTTTTTGCTACAGTAAAAA GCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATC >DTH_1N_18_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=330; TTAGAGCCCGTTTAGTTTTAATTTAAATTTTTAATTCGAGTTAAAATATAATTTTATGTGAAAGTTTTTTATTGTAATAA AAAAGTTAAATGTGATTATTTCTGAGAGCTTTTTACTGTAGCAAAACTCGAATCGGTGAAATGAACGGGGCCTAGAAATA AATATATTAGCCGTTCATTTCACCAATTTGAGTTTAGAATTCGAGTTTTATTACAGTAAAAAACTCTCATAAAAAGTCAC ATATAACTTTTTTATTACAATAAAAAGCTCTCACATAAATAACATCTCAACTCAAATTAAAAACTCAAATCAGCGAACTA AACGAGCTTT >DTH_1N_19_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=144; ACTTCGCAGATTTGAGTTTTTAATTCGAGTTGAGATGTGATATTTTTTGAGAGCTTTTTACTGTAGCAGAAAAAGTTAGA TGTGACATTTTCTGAGAGTTTTTTACTGTAAAAATTTAAAACTGAAAACTCAAATCGGTGAAAT >DTH_1N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=536; GGGCTTGTTCTTTTAGAGTAAAACTCAAAAAAAATTTGAACTCAAGTTACAACTTTATTCAAGTTCATGTTCTTTTGTAA AATTTGAGTTTGAACTTGAGTTTTAACTTGAGTTTGGGGCTAAAATCTGAGTTCAAGTTTCCCCTTCAACTCAAGTTCTT AAACTCAAACTCAAGTTAATGAACAATATTTTTTCTATTCTTAAAAACGTCATAACTTTTTCGTTTTAATTCCGATTGAG ATGATTTTTTTTCTATGCGTTCACAACGAAGAGACGAATAAAACCCCACCCATATACCCTATTAAAATTTTTCATCACCA TTGAGTTTTTATTAAAATACTATCTAAATACAAATTCAAGTTTTGACCCACTCAAACACAAACTCAAATAGATTCTCAAT TCAAATCATAACTCAAATGTGCACATCCAAACACAAACTCAAGTTACAACTTCAACTCAAATTATAACTCAAATTCAACT CAAGATCTACACTCAAGTCACCATAACTCAAAAATGCAACCGAACAAGCCCTTAAT >DTH_1N_20_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=164; GGCCTCGTTCACTTCGCGGATTTGAGTTTTCAATTCGAGTTGAGATGTGATATTTTTTAAGAGTTTTTAACTGTAACAGA AAAAGTTAGATGTGACATTTTCTGAGAGTTTTTTACTGTAAAAACCTAAAACTGAAAACTCAAATCGGTAAAATGAACGA GACC >DTH_1N_21_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=158; TGAACAATTTAATACAAATTATTAAGGCCCCGTTCATTTCGCCGATTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAA AGCTCTCAGAAACAGTCACATCTAACTTTTTTACTACAGTAAAAAGCTCTCACACAAAATCACATCTCAACTCGAATT >DTH_1N_22_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=152; AGGCCCCGTTCATTTCACCGATTCGAGTTTAGAATTTGAGTTTTGTTACAGTAAAAAGCTCTCAGAAACAATCACATCTA ACTTTTTTACTACAGTAAAAAGCTCTCACATAAAGTCACATCTCAACTCGAATCAGCGAACTAAACGGGCCC >DTH_1N_23_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=127; ATTCGAGTTTTCAGTTTTAAGTTTCTACAGTAAAAAGCTCTCAGAAAATGTCACATCTAACTTTTTCTGCTACAGTGAAA AGCTCTCAGAAAATGTCACATCTCAGCTCGAATTGAAAACTCGAATC >DTH_1N_24_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=136; TTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGTTTTTTACTGTAGTAAAAAAGTTAAATGT GACTGTTTTTAAGAGCTTTTTACTGTAACAAAACTCGAATCGGTAAAATGAACGGG >DTH_1N_25_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=111; GATTCGAGTTTTGTTACAGTAAAAAGCTCTCAGAAACAGTCACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATA AAGTCACATCTCAACTCGAATTAAAAACTCG >DTH_1N_26_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=116; TGATTCGAGTTTAGAATTTGAATTTTGTTACAGTAAAAAGCTCTCATAAACAATCACATCTAATTTTTTTACTACAGTAA AAAATTCTCACATAAAATCACATCTCAACTCGAATT >DTH_1N_27_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=131; CCGTTCACTTCGCTGATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGATTG TTTGTGAGAGCTTTTTACTGTAGAAAAACTCGAATCAGCGAAGTGAACGGG >DTH_1N_28_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=120; GGCCTCGTTCAGTTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTAACTGTAGCAAA ACTCGAATTGAAAACTCGAATCGGTGAAATGAACGAGGCC >DTH_1N_29_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=154; TTTTACAAATTTAAATTTTTAATTTAAATTGAGATATAATATTTTTTAAAAATTTTTTATTGTAATAAAAAAAATTAAAT GTGATATTTTTTAAGAATTTTTTACTGTAAAAATTTAAAATTAAAAACTCAAATCAATAAAATAAACGAGACCT >DTH_1N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=1048; TGTTCTTTTGTATTAAAATTTAAAAAAAATTTGAACTCAAGTTATAATTTTATTCAAGTTCATGTTCTTTTATAAAATTT GAGTTTGAACTTGAGTTTTAACTTGAATTTTAACTTGAGTTTGGGCTAAAATATGGAGGGTTTGTTCTTTTAGAGTTTGA CTTGAGTGTAGTTTTTGAGTTGAATTTGAGTTATAACTTGAGTTGAAGTTGTAACTTGAGTTTGTGTTTGGTTGTGTACA TTTGAGTTATGGTTTGAGATAAGAATCTTTTTGAGTTTGTGTTTGAGTGAGTCAAAACTTAAATTTGTATTTAGATAGTA TTTTAATAAAAACTCAATGGTGATGAAAAATTTTAATAGGGTATATGGGTGAGGTTTTATTCGTCTTTTCGTTGTCAACG CATAGAAAAAAAATCATCTCAATCAGAATTAAAACGAAAAAGTTATAGCATTTTTAAGAATAGAAAAAATACTGTTCATT AATTTGAGTTCGAGTTTCTGAACTCGAGTTGAAGGGGAAACTTGAACTCGAGTTTTAGTCCCAAACTCGAGTTCAAACTC GAGTTTAAACTTAAAAGAACATGAACTTGAATAAAGTTGTAACTCGAGTTATCTTTTTTTGAGTTTTTAAGTCAAAAGAA CAAGCCCTAAGTTTCCCCTTCAACTCAAGTTCTTAAACTCAAACTCAAGTTAATGAACAATATTTTTTCTATTCTTAAAA ACGTCATAACTTTTTCGTTTTAATTCTGATTGAGATGATTTTTTTTCTATGCGTTCACAACGAAAAGACGAATAAAACCC CACCCATATACCCTATTAAAATTTTTCATCACCATTGAGTTTTTATTAAAATACTATCTAAATACAAATTCAAGTTTTGA CCCACCCAAACACAAACTCAAATAGATTCTCAATTCAAATCATAACTCAAATGTACACATCCAAACACAAACTCAAGTTA CAACTTTAACTCAAATTATAACTCAAATTCAACTCAAGATCTACACTCAAATCACCATAACTCAAAAATACAACCGAACA AGCCCTAA >DTH_1N_30_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=83; ATTCGAGTTTTCAATTCGAGTTGAGATGTGACATTTTCTGAGAGCTTTTTACTGTAGAAACCTAAAACTGAAAACTCGAA TCG >DTH_1N_31_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=579; AAGCCCCTGTTTGTTTCAACAACTCAAACTGTTGTTTAGGATTCAAACCTTAGTTCAGGATTCAAATTGGTGTTTGGGAG AGGAAAATTCAAGGACAATTCAAACCATTAACAATGGTTCAAGGACAACTCAAATTGTTGATTTTAGAATTCACCTCCCC CCTAAATTCTAACAATCCGAATTGTTGTCAACAGTCTAATAGTTTCAGATTCTACTTTTTCTCTCTCTTCAATTTCAATC TTAAAAATGTCATAACTTCTTCGTTTTAATTCCGATTGAGATGATTTTTTTTAATGTGTTCATAATGAAGAGAGGAACAA ATCCCCACCCATATTGCATATTTTTTAATGTCATTTATAATGAGGTTTTATAAGATTTGTTACAAAACTCTAATGACAGT TTTCAACACTTTATCCAAACACAGTTCGGATTTTATTCCCAATTCAAATTACAATTTATTTGCATATCCAAACAACAGTT CGGATCACAGTTTGAATCACCACAGTTCAGATTCTACAGTTCTAACAAAAAAGGTTCAAATCTCCACAGTTTGAGTTGTT GAACCAAACAAGCCCTAAA >DTH_1N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=671; TAAGGGCTTGTTCTTTTGAGTGAAAAACTAAAAAAAATACAACTCGAGTTACAACTTTATTTGAGTTCATGTTCTTTTAA GTTTAAACTCGAGTTTAAACTCGAGTTTGGACTAAAACTCGAGTTTAAGGCCTCGTTCAGTTCGCTGATTCGAGTTTTTA ATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGATTGTTTCTGAGAGCTTTT TACTGTAGCAAAACTCGAATTCTAAACTCGAATCGGTGAAATGAACGGGGTCCCCTTCAACTCGAGTTCAGAAACTCGAA CTCAAATTAATGAACAATATTTTTTCTATTCTTAAAAATGCTATAACTTTTTCGTTTTAATTCTGATTGAGATGATTTTT TTTCTATGCGTTGACAACGAAAAGACGAATAAAACCCGACCCATATACCCTATTAAAATTTTTCATCAGCATTGAGTTTT TATTAAAATACTATCTAAATACAAATTCAAGTTTTGACTCACTCAAACACAAACTCAAAAAGATTCTTATCTCAAATCAT AACTCAAATGTACACAACCAAACACAAACTCAAGTTACAACTTCAACTCAAGTTATAACTCAAATTCAACTCAAAAATTA TACTCAAGTTAAACTCCAAAAGAACAAGCCC >DTH_1N_5_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=338; TATTAAGGCCTCGTTCACTTCGCGGATTTGAGTTTTCAATTCGAGTTGAGATGTGATATTTTTTGAGAGTTTTTTACTGT AGCAAAAAAAGTTAGATGTGACATTTTCTGAGAGCTTTTTACTGTAGAAACCTAAAACTGAAAACTCGAATCGGTGAAAT GAACGAGGCCTAAGGCCTCGTTCATTTCACCGATTCGAGTTTTCAATTTTAGGTTTCTACAGTAAAAAGCTCTCAGAAAA TGTCACATCTAACTTTTTTTGCTACAGTAAAAAGCTCTCAAAAAATATCACATCTCAACTCGAATTAAAAACTCAAATCC GCGAAGTGAACGAGGCCT >DTH_1N_6_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=186; AATAAAAATTAAGGCCCCGTTCATTTCGCTGATTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAAAGCTCTCACAAAC AATCACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATCAG CGAACTAAACGGGCCCTAAATTTTTA >DTH_1N_7_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=206; AAAAATTAAGGCCTCGTTCGTTTCGCTGATTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAAAGCTCTCACAAACAGT CACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTCTAAACTCGAATCAGCGA AACGAACGAGGCCTTTGATTTTAAAATTAAATAAAAAATAATATAT >DTH_1N_8_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=340; GCTGATTCGAGTTTAGAATTTGAGTTTTGCTACAGTAAAAAGCTCTCACAAACAGTCACATCTAACTTTTTTACTACAGT AAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATCAGCGAACTGAACGGGCCCTTTAAAATAAT TTTTAATTATAACTTCGAATAAAATTTTTAGGGCCCGTTCAGTTCGCTGATTCGAGTTTTTAATTTGAGTTGAGATGTGA TTTTATGTGAGAGCTTTTTACTGTAGTAAAAAAGTTAGATGTGACTGTTTGTGAGAGCTTTTTACTGTAACAAAACTCAA ATTCTAAACTCGAATCAGTG >DTH_1N_9_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=174; ATTTTTTTTATAAAAAAAAATAGGCCCCGTTCACTTCACCGATTCGAGTTTAGAATTTGAGTTTTGCTACAGTAAAAAGT TCTCAGAAACAGTCACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTACAAA CTCGAATCAGCGAA >DTM_1N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=193; TAAGAGAAATGCTAGCATCACTCTTTCTGTCACTCTTTTTGTCACTTTCTGCATTCACTGTTTGACACGTGGACTCCACT AACATGATATATTATTATTTAAACAGAAAATGAGATAGTAGAGTCCACGTGTCAAACAGTGAATGCAGAAAGTGACAAAG AGAGTGACAAAAGAGTGACGCTAGCATTTCTCT >DTM_1N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=155; GAAATGCTAGTTGTCACTCTTTTTGTCACTTTCTGTATTCATTGTTTGACATGTGGACTCTACTATCTCATTTTCTATTT AAATAATAATATATCATGTTAGTGGAGTCCACGTGTCAAACAGTGAATGCAGAAAGTGACAAAAATAGAAAGAGT >DTM_1N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=154; AACATCACTCTTTCTGTCACTCTTTTTATCACTTTTTACATTCATTGTTTGACACGTGAACTCTATTAACATGATATATT ATTATTTAAACAGAAAATGAGATAGTAGAATTCACGTGTCAAACAGTAAATGCAGAAAGTGACAGAAAGAGTGA >DTM_1N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=140; TCACTCTTTTTATCACTCTCTACATTTATTATTTGACATGTGGACTCTACTATCTCATTTTCTATTTAAATAATAATATA TCATGTTAGTGGAGTCCACGTGTCAAACAGTGAATGCAGAGAGTGACAAAAAGAGTGATG >DTM_1N_5_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=107; ACTCTCTGCATTCACTATTTGACACGTGAACTCTACTAACATGATATATTATTATTTAAACAGAAAATGAGATAGTAGAG TCCACGTGTCAAACAATAAATACAGAG >DTM_1N_6_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=165; TCTTTTTGTCACTCTCTTTTATTATTTGACACGTGAACTCCACTAACATAATATATTATTATTTAAACAGAAAATAAAAT ATGATCATATGTCAAACAGTGAAAAATAAGTTAGTAGAGTTCACGTGTCAAACAATGAATGCAGAAAGTGACAGAAAGAG TGATG >DTT_1N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=124; AGAGTGCATGAGTCTGGACTTTTACCCTTTATTCTTGATAAATACCCTTTTGTTAGTGTAATTATTTGACTAAAAAGGTT ATGAATCAAGAGTAAAGGGTAAAAATCCTGACTCATGCACTTTC >DTT_1N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=124; AGAGTGCATGAGTCTAGATTTTTATCTCTTACTCTTGATTAATACCCTTTTGACTAATATAGTTATTTGACTAAAAAGGA TATTAATCAAGAGTAAGAGATAAAAATCCAGACTCATACACTCT >DTT_1N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=110; TGAGTCTGGATTTTTACCCTTTACTCTTGATTAATATCCTTTTTAGTTAAATAACTATATTAGTCAAAAGGGTATTAATC AAGAGTAAGGGGTAAAAATCTAGACTCATG >DTT_1N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=138; ATCCTTAAGAGTGTATGAGTCTGGATTTTTATCCTTTATTCTTGATAAATACCCTTTTATTAGTATAATTATTTGACTAA AAAGGTTATGAATCAAGAGTAAAGGGTAAAAATCCTGACCCATGCACTTTTAAAGGGT >DTT_1N_5_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=93; AGATTTTTACCTCTTACTCTTGATTAATATCTTTTTAGTCAAATAATTATATTAGTCAAAAAGATATTAATCAAGAATAA AAGGTAAAAATCC >DTT_1N_6_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=129; TGCATGAGTCAAAATTTTTACTTTTTATTCTTAATTCATAATTTTTTTAGTTAAATAATTACACTAATAAAAGAATATTT ATTAAAAATAAAAGGTAAAAATCTAGACTCATACATTTTTAAAAATAAA >DTX_1N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=262; TTTTATATATATATATATATATATATAGGTGTAGTTTTAATAGTTACTCTAATATTTATTTATTAATGAGTATTATTATT TTAACTGTAAGATATTAATCTGACGGTTATAATAAATTAGATAGTTGATTAAAAAAATTTATGATAATTAATGAAATTAG ATTCTTATCACGTCACATCATTAAATTTTTATATTTAATAGTAACTACCGATAAAAACGTAACTATTAAAAACTCGTATA TATATATATATATATATATTAT >DTX_1N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=222; TATATGGGTGTGGTTTTAATGGTTACTCCAATATTTATTCATTAATGGGTATCATTATTTTAGCCGTAAGATATTAATCC GACGGTTATAATAAATTATATAGTTGACCAAAAAAATTTATGACAATTAATGAAATTGGATTCTTATCACGTCACGTCAT CAGATTTCTATATTTAGTGGTAACCACCGATAGAAACGTAACCATTGAAAACTCGTCTATAT >DTA_2N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=814; TAGAGATGCAACAATGGGCCGGGGCCCGTGGGCCGGCCCAGGCCCATCCTGACACAGTGACGGGCCGGGCCGGCACGGCC CGTCACTGTTCAAGGCACGGCCCAGCCCATAAATATTGGTGGGCTGGGCTGGGCCAACATATATCGGCCCATGGGCCGGC CCGGCACGGCCCATGAAAAATCATGGGCCAGGCGGCCGGCCCGTCTAGGCCCATGATGGGCCGGCCCAGCCCGGCCCGTC TAGGCCCATAATGGGCCGGCCCAGCCCAGCCCATCTAGGCCCATAATATTTTTATGTTTTTTTTTTTTTTTTAGTAATTT TGTAAACATCTTATGTATAATTATCCTGATTGTACTCTTTTTTTCTTACCAAGGTTTTGTCCCACTGGGTTTTCCTTAGA AAGATTTTTATTTAATGAGGTAATCGTAAATAAAATATCATTTTTCATATTTCCATTGACTATTCAAACTTATATATTTG TTAACTTGTTTAAAAATTCAAAAATAAAAATTAAAAAAAAAATTAAAAATTACATGCTTAGATGGGCTGGCCCATCTAAA CCCATGATGGGCCAAGATGGGCCTTGAGTGGGCCAGCCCATTCAAGGCCCATGGCACGGCCCATCCTGGCCCGCGGCACG GCCCAGCCTGGCCCACGTAAAATTGGCCCGTGGTGTGGGCTGGGCCGAGGTCATTCTTATACGGGCCGGCCCGGCCCGGC CCACAAAATTCGTGGGCTGGGCCGGCCCGGCCCGCGGCCCGCGTGGGCCTAAGGAGAACGGGCCGGGCCGGGCCGGCCCG TTCTTGCATCTCTA >DTA_2N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=1544; GTAAGCAGTGTTGGAAGTTCGGGTCGGCGGGCTGCCCGAAGCCCGAATTTTTTCGGGCTCGGGCGGGCAAGCCCATCTCC CGCCCGCCCAAGCTAGATTTTCGGGTTCGGGCTCGGGCAGCCCGAATTTGACACTAACTCTCTTGCCCGCCGCCGTCTAA CCGCCCTATACCGCCGTCCGCCGGAATTTTTTTGAATTTTCCGACCATGCCCGACCCGCCCGAATTGCCCGACCCGAAAA TAAGCCCGAAAACCCGAATTTTGCCCGAAGCCCGAGTTGCCCGATTTGCCCAAAACCGCCCGAAAATATTAGTTGCTACA AATTGGGGCATTCCGAGAATCGAACTCGGGACCTCTCACACCCAAAGCAAGAATCATACCACTAGACCCAATGCCCATAT TTGTTATTTAAATTTTTAACTTTTTAATTAAGGTAAACACACAATTCCTTAATAGAAAGAGCAAATTCCTATTTTAGCAG TTTAATATTTCAGTTTTCACATTCTTGACCCTTTTTTATAATCAATCACATGATAAAATGATTCCTCAAAAAACAATATA CACAAGGAAAGAAACACATTGCCATCACGTTTTTATTATTTTTTATTTTTAAAAAGTGTTGTTTCTATATAATGCCGGTT TTGTTCTTATAGATACTCGTGTTTTTCTATTCTATATCACTCTTCTTTCTATCTTTATCTATTTTTCTGTTCACAATCTC TCCTCATCCTCTTAATTATCCTCTTTTTTCTTCAACTTTCTTCACTCTCTTTGTGACTCTATATCAAAGTAACTTTCTAC TTGCATACCAAAGTAAATTGATAATTTATCAAAAGTCACTCAATGATTGGTTTGGTTTAATAACTTCATCGCTATTTGAT GATCTCTATTTTAAAAGACCAGTCACTCAATGTTGAAGCCTTGGTTTGCATTAAGGATTGGGATCGGGCCGATCAACATT TACAAGATACAATTTCACCGGCAAGCCAATAATGGATCGATGAATTTAATCGATTAACATTTAATTTTGAAGACGATCCT TTAGCTTTAAATTAAATTGTAAATTTGTAATTTGTAAATATGTATTTACCTTTGACATTGTATTTGTAATTGTATAACTT TGTAAGTTTGTAAAATTTGTAATTCGTCACAATATGATTGCACTCTTTTTTCCTTGCCAAGTTTTTATCCCAATTGGGTT TTTCTTGGTAAAGTTTTTAATGAGGTAATCATGAATTATAAATTTAAAAATTAATAAAGAAAGAATTTTTTTATATAGTT CGTGTGTTCATTTCAAATTTCAAATTGTAATATATATATATATAAATTTTAACACAAAATAACTTAATATTAAAAAAAAA GTTTAAATAATTCGGGCAATTCGGGCGGGCTCGGGCCGCCTAATACAAGCCCGCGGCCCGTTCAAGGTGAAATTCGGGCT CGGGCGGGCGGCCCAAATTTCTCGGGCGGCTCGGGCTCGGGCTCGGGCAAAAACTCAGGCTTTTCGGGCGGTCGCGGGCG GCCCGTCCAAAGTTCCAGCACTAT >DTA_2N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=710; AACTAGTGCTGGAACTTTGGACGGGCCGCCCGCGACCGCCCGAAAAGTCCGAGGATTTGCCCGAGCCCGAACCCGACCCG CCCGAGATTTTCGGGCCGCCCGCCCGAGCCCGAATTTCACCTTGAACGGGCCGCGGGCTTGTATTCGGCGGCCCGAGCCT GCCCGAATTGCCCGAATTTTTTAAATTTTTTTTAATATTAAGTTATTTATATATATATTACAATTTGAAATGAACACACG AACTCGGGTTTTCGGGCAGAATTCGGGTAAAAATTCAAAAAATAGCCATTTTTGGGTTTTCGGGCAACTCGGGTTTTCGG GCAAAATTCAAAAAACTAGCCGTTTTCGGGTATTCGGGCAATTCGGGCACCTCGGGCGGGTCGGGCAATTCGGGCAGGCG GGAAAAATTCAGGCAAAATTCAAAAAAAATTCAAAATTCAGGCTTCGGGTCGGGCAATTCGGGCACACCCAATTTTCGGG CAATTTTCGGGTTGGGCAGTTCGGGCTTGGTCGGAAAAATTCAAAAAAATCCCGGCGGACGGCGGTATACGGTGGTTAGA CGGCGGCGGGCAATGGTGGACATGTCAAATTCGGGCTGCCCGAGCCCGAACCCGAATTTCTTGCTTGGGCGGGCAGGAAT TGGGCCGGCCCGCCCAAGCCTGAAAAAATTCGGGCTTCGGGCGGCCCGCCGACCCGAAGTTCCAGCACTA >DTH_2N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=126; GAGCCCGTTTGGTTCATGGATTAGAACCATTTTCGATTTACGTGTGTTTTTTGTGAGAGAAAATACTGTAGCGAACCATG AACCATGATTCGAATCAGAGAACGAATCCTCCAACCAAACGGGCTC >DTH_2N_10_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=132; TGGTTGGAGGATTCGTTCTCTGATTCGAATCATGGTTCATGGTTCGCTACAGTATTTTCTCTCACAAAAAACACACGTAA ATCGAAAATAGTTCTAATCCATGAACCAAACGGGCTCTAAATTTTTATAAAA >DTH_2N_11_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=158; AGTGGACGTTTGGTTCATAGATTTAGAATCATGATTTAAAATTATTTTTGATTTACGTGTATTTTTTATGAGAAAAAATA CTGTAACGAATCACGAATTATGATTCAAATCATGATACGAATCTACCAACTAAACGCACTTCATTTATATTTCATTAA >DTH_2N_12_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=137; TGTGCGTTTGGTTGGTAGATTCGTATCATGATTTGAATCATAATTCGTGATTCGTTACAGTATTTTTTCTCATAAAAAAC ACACATAAATTGAGAATGATTCTGAATCATGATTCTAAATCCATGAACCAAACGTCC >DTH_2N_13_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=120; TAAGGGGACGTTTGGTTCATGGATTCAGAACCATTCTCGTTTTACGTGTGTTTTTTGTGAGAGAAAATACTGTAACGAAC CACGAACCATGATTCGAATCATGGCACGAATCCCCCTTCC >DTH_2N_14_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=130; GTTTGGTTCATGGATTCAGAATCATGATTCAGAATCATTCTCGTTTTACGTGTATTTTTTGTGAGAGAAAAACACTGTAG AGAATCATGAATCATGATTCAGAATCATGGACGAATACAGGAAACAAACA >DTH_2N_15_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=208; GAAACGTTTGGATCACGAATTAGATACTTTATAAGTTTTTATTTATTGTAAATTTTGTGAGATCTTCATATATTAGTTGT TGTTTAGTTGAGAGATTCATTTTCTGATTTGAATTATGATTTATAATTTGTTACAGTATTTTCTTTTATAAAAAATACAC GTAAATTAAAAATAATTCTAATCACATGATTTTAATCCATGAACTAAA >DTH_2N_16_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=133; GTGGACGTTTGGTTTATAGATTCAGAATCATGATTTAAAATTATTTTTAATTTACGTGTATTTTTTATGAGAAAAAATAC TATAACGAGTCACGAACTATGATTCGAACTATGACACGAATCCTCATACCAAA >DTH_2N_17_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=93; GATTAGAATCATGAGATTAGAACTATTTTTGATTTACGTGTATTTTTTGTGAGAGAAAACACTATAGTGAATCATGAACC ATGATTCAAATCA >DTH_2N_18_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=101; TGGATTCAGAATTATTCTCAATTTACGTGTATTTTTTATGAGAGAAAATACTGTAACGAATCACGAACCATGATTCGAAT CATGGCACGAATCTACCAACC >DTH_2N_19_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=130; AGACGTTTGGTTCATGGATTAGAATTATTTTTAATTTACGTGTATTTTTTATGAGAGAAAATACTGTAACGAATCATGAA TTATAATTCAAATCATGATATGAATCCTCTTACCAAACGTCTCTTAAATT >DTH_2N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=96; ATACTCAAACCATAATTCTTGATTTTGACGTTTGAAATTCAAATTTTTTGTGAGAGAAAAATACTGTAACAGAATCAATA ATTTGAGTTTGAGTAT >DTH_2N_20_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=131; AGAGGACGTTTGGTTTATGTATTCAGAATTATTCTCGTTTTACGTGTATTTTTTGTGAGAAAAAAATACTGTAGAGAACC ATGAATCATGATTCAGAATCAGGGACGAATATAGGAAACAAACGTCCCCTT >DTH_2N_21_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=84; TGATTCAAATTATAATTCGTGACTTATTACAGTATTTTTTCTCATAAAAAATACACGTAAATCGAAAATAATTCTGAATC ATGA >DTH_2N_22_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=82; AAAATTATGATTCATAATTATTTTTAATTTATGTATATTTTTTATGAGAAAAAATATTATAATGAGTCATGAATTATGAT TC >DTH_2N_23_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=80; CATGATTTATAATTTATTATAATATTTTCTCTCATAAAAAATACACGTAAATAAAAAATAATTCTAATCTCATAATTCTA >DTH_2N_24_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=134; CGTTTGTTTCAAGGGTTCTGTCTGGTTTAGGATCATGGTTCTTAGTTCTGTTACAGTGTTTTTCTCTCACAAAAAATTTA AATTTTAAAAATCAGAATCATGAACTATGATTTTAAACCCATGAACCAAACGTC >DTH_2N_25_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=95; GGTTCAGAATCATGATTCATGATTTTGATTTTTGAAATTTAAATTTTTTGTGAGAGAAAAACACTATAGAGAATCAAGAA CTATGATTCAGAACC >DTH_2N_26_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=131; GGGCTCGTTTGTTTCATGCGTTTAAACTCATGATTTTGATTCTGCTACAGTGTTTTCCTCTCACAAAAAATTTAAATTTC AAATGTCAAAATCAAGAATCACTGGTTTAAACGCATGAACCAAACGGGCCC >DTH_2N_27_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=114; ATATGGGTTCTGCTACAGTGCAAACCCATGGTTTTGGTTCTGCTACAGTGTTTTTCTCTCACAAAAAATTTGAATTTCAA AAGTCATAATCAAGAACCTTAGTTTGAACCCATA >DTH_2N_28_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=101; TGCGTTTAAATTCATAGTTTTGATTCTGCTACAGTGTTTTTCTCTCACAAAAAATTTGAATTTCAAATGCCAAAATCAAG AATCACTGATTTAAACGCATG >DTH_2N_29_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=131; ATATGGGTTCTTCATGGGTTCAAACCCATGGTTTTGATTCTGCTACAGTGTTTTTCTCTCACAAAAAATTTAAATTTCAA AAGTCATAATCAAAACCACTGGTTTGAACCCTGGTTTGAACCCATATACCA >DTH_2N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=133; AGGGCCCGTTTGTTTCATATACTCAAACTCAAATCATTAATTCTGTTACAATGTTTTTCTCTCACAAAAAATTTAAATTT CAAACGTCAGAATCAAGAATCATGGTTTGAGTATACCTTCCAAACGGGCCCTA >DTH_2N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=143; TAGGGGATGTTTGGTAGGGGGATTCGTTCCCTGATTCGAATCATGATTCGTGGTTCGCTACAGTATTTTCTCTCACAAAA AATACACGTAAATCGAAAATGATTCTAATCTCATGATTCTAATCCATGAACCAAACGTCTCCT >DTH_2N_5_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=161; TAATTTAGGGGTTGTTTGGTTGGGGGATTCGTACCCCGATTCGAATCATGGTTCATGGTTCGCTACAGTATTTTCTCTCA CAAAAAATACACGTAAATCAAAAATAGTTCTAATCTCATGATTCTAATCCATGAACCAAACGTCTCCTAATTTTTCTTAT T >DTH_2N_6_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=271; CGTTTGGTTCATGGATTAGAATCATGAGATTAGAATCATTTTTGATTTACGTGTATTTTTTGTGAGAGAAAACACTGTAG CGAACCATGAACCATGATTCAAATCAGGGTATGAATCCTCCAACCAAACATCCCCTAAGGGGATGTTTGGTTGGAGGATT CGTACCCTGATTTGAATCATGGTTCATGGTTCGCTACAGTGTTTTCTCTCACAAAAAATACACGTAAATCAAAAATAATT CTAATCTCATGATTCTAATCCATGAACCAAA >DTH_2N_7_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=245; AGGGATTCGTTCTCTGATTCGAATCATGATTCGTGGTTCGCTACAGTATTTTCTCTCACAAAAAATACACGTAAATCGAA AATGGTTCTAATCACATGGTTCTAATCCATGAACCAAACGTCACGTTTGGTTCATGGATTAAAACCATGTGATTAGAACC ATTTTCGATTTACGTGTATTTTTTGTGAGAGAAAATACTGTAGCGAACCACGAATCATGATTCGAATCAGGGAACGAATC CCTCT >DTH_2N_8_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=129; GTTTGGTTCATGGATTAGAACCATGAGATTAGAATTATTTTTGATTTACGTGTATTTTTTGTGAGAGAAAATACTGTAGC GAACCATGAACCATGATTCGAATCAGAGAACGAATCCTTCAACCAAACG >DTH_2N_9_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=146; TAGAGCCCGTTTGGTAAAGGGATTCGTTCCCTGATTCGAATCATGATTCGTGATTCGTTACAGTATTTTTTCTCATAAAA AATACACGTAAATTAAAAATAATTCTAATCACATAGTTTTAATCTATGAACCAAACGGCCTCTTAA >DTM_2N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=179; GGGAGTTTCTCTGGTAGTCCGCCCTACCGGTAGTCTCAGTTTTTGACCGTTAGATCTGGTCAAAATCACATCAGATTAAA AAAATATGCAGAACAGACAGATTTTGATACAAATCTGACGGCTGAAAAGTAAAAAACTACCGATAGTCTATTTTTACAAG GACTACCAGAGAAAGTCCC >DTM_2N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=146; ACTACTGGTAGTTTCTTACTTTTCAGCCATTAGATCTATATCAAAATCTGTCTGTTCTGCATATTTTTTTAATCTAATGT GATTTTAACTAGATCTAACGGTTAAAAACTGAGACTACCGGTAGGGTGGACTACTAGAGAAACTCT >DTM_2N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=187; TTGGGACTTTCTCCAGTAGGTCTCTCTACTAGTAGTATCAGTTTTTGACCGTTAAATCTAGTTAAAATCACATCAAATTA AAAAAATATGCAGAACAGACAATTTTTAATACAAATCTGACGATTGAAAAGTAAAGAACTATCAGTAGTTCATTTTTTCT GATCCTACTAGAGAAACTCCCTTATAT >DTM_2N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=125; TACCGATAGTTTTAATTTTTAACCGTTAGATCTGATCAAAATCACATCAAATTAAAAAAATATGCAGAACAAACAGATTT TGATACAGATCTGACGGCTGAAAAATAAGAAACTACCGGTAGTCT >DTT_2N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=182; GGCTATTTTACTCCATCAATAGGAATTGTGTTTTAACTGTTGGATTAATTTTTTAACAGTTTGATTTGCAGTAGGAGTAG TTTTGTATCGCACGTTGTAAATTTTTAATATAAACATGTACAAATCTAACTGTTAAAAAATTAATCCAACAGTTAAAAAT AATAATTTCTATTAGTAGAGCA >DTT_2N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=151; GGGATAAGTGTTTTTAATTGTTGGATTAGTTTTTTAACAGTCAGATCTGTGCAGGTCTGTATTAAAAATTTACAGCGCGC CACACAAAACTGCTCTTGCTGCAGATCTGACCGTTGAAAAATTAATCCAACAGTAAAAACACTTATCCCAC >DTT_2N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=121; TACTGTTGGATTAATTTTTTAACGGTCAGATCTGTAATAAGAATAGTTTTATGTGGCGCGCTATAAATTTTTAATACAAA TATATACAGATCTAACCGTTAAAAAATTAATCTAATAGTTA >DTT_2N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=120; GCTATTGGATTAATTTTTCAATGGTTTGATGTGTAGTAAGAGCAGTTATGTGTTATGCACTACAAATATTTAATATGGAC ATTCACAGATTAAACTGTTAAAAAATTAATCCAACAATTA >DTX_2N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=432; AAAAGGCGCCTCACACTCCGATGGCCCACCGGCGAAGTATTGTCCCCACTTGGGCCCGCCGTGACGGGTGGGGTTTTGTC CCTTCGTAAAAGGCGCCTCGCTGGTAGGAGGGGTTGGCACTCTGGACTATACCTCTCCAGACCCCCGTCTCCAACCGATG TGAGATTTGGTTCAACAGTGCGACTCCACTGGGGACGTTTGGCCACGGCCTGCCTCCCCAGTCCCCCCGTCTCGGGGGGC ACTGTTGTACACCAAGAGTCCCACATCGGTTGGAGACGGGGGTCTGGAGAGGTATATGTACCAGAGTGCCAACCCCTCCT ACCAGCGAGGCGCCTTTTACGAAGGGACAAAACCCCACCCGTCACGGCGGGCCCAAGTGGGGACAATACTTCGCCGGTGG GCCATCGGTGTGTGAGAAATTCTGGTATCAAC >DTX_2N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=685; CCAGAATTTCTCACACACCGATGGCCCACCGGCGAAGTATTGTCCCCACTTGGGCCCGCCGTGACGGGTGGGGTTTTGTC CCTTCGTAAAAGGCGCCTCGCTGGTAGGAGGGGTTGGCACTCTGGTACATATACCTCTCCAGACCCCCGTCTCCAACCGA TGTGGGACTCTTGGCATACAACAGTGCCCCCCGAGACGGGGGGACTGGGGAGGCAGGCCGTGGCCAAACGTCCCCAGTGG AGTCGCCAACTGTTGATACCAGAATTTCTCACACACCGATGGCCCACCGGCGAAGTATTGTCCCCACTTGGGCCCGCCGT GACGGGTGGGGTTTTGTCCCTTCGTAAAAGGCGCCTCGCTGGTAGGAGGGGTTGGCACTCTGGTACATATACCTCTCCAG ACCCCCGTCTCCAACCGATGTGGGACTCTTGGCATACAACAGTGCCCCCCGAGACAGGGGGACTGGGAAGGCAGGCCGTG GCCAAACGTCCCCAGTGGAGTCGCCAACTCTTCATACCAGAGAGTCCCCACACCTGTTGACGGCGGTCCGGAGAGGTATT GTACCAGAGTGGCACCCGCTGCGACTGGTGAGGCGCCTTTTACGAAGGGACAAAACCCCACCCGTCACGGCGGGCCCAAG TGGGGACAATACTTCGCCGGTGGGCCATCGGTGTGTGAGAAATTC >DTA_3N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=538; TAGGGGTGTAATTCGGCCGGGTAGGGTCGGGTTGAGCCGAAAAATTGAGCCGACCCGCTCAGTGCGGGTTGAGAAAATTT TAGGCCGCAACACTCTCTTAAGCCCACAAACCCGCAACCTGTCGGGTGACCTCGGGTAGGCTCGGGTTACTCGGGTTGGT GAAAACCAATTTTAATCTATGACTTCATACCTCTTTTAACAGTCCAAAAGCATAAAATCCATAAACAGTCCATAAGCATT AACATAACATCAAACATACTTCTTAACAGTCAATAAAGTCCAGAAATAAAATTAACAATACGTCAAATAAACAGTCCATA TAGAGATAGTCCAGCAAAATAGATTTAGGGATTTAGGGTTACACACCTAAATCGGGTCGGGTCGGGGCAAAGCGGGTTCA AAATGCCCGCCCCGCCCCCCAACCCGCACAGTGCGGGTTGGGACTATTTGAATCCGAATTTTAAAAAAAAAAAACCCTAC GCTTTCGGGTCGGGTCGGGGCGGGTTATTCGGGTTCGGGCTCATTTCTTACACCCCTA >DTA_3N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=680; TAGGGCTGTAAGAAATCACCCCGAACCCGACGAACCCGGCCGAGCCGAGCCGACCCTACTCGAAAATCACGGGTTTCTAA TTTTTTATTTAATTTTCAGTTTTAATTATGCCTAACCCGCACTGCGCGGGTAGGGGCGCGGGGTGGGGTTACATGAACCC GAGGTAACCCTACCCGGCCGAACATGTTCAAAGTAGGTAAAACAATGTCCAACACTTCAAATTCTTACTTTCATAAGTTT ATGGACTTTATGCTTTTAAACTGTTAACTTATTTATGTTTTGGATTCACGGTTTGTGTAAAAAATGCTTGTATGCCATAG TTGTTGAATTAGGACATTCTTTATTTATATTGGAAGTGTTTGATTTCAAAGTGAGTGTTTTAATTGTTCACCTTGCATTT AGACCCCCTCTTGAAGGAAAGACATGTTCTGTTTGATAATGATTTCTTCTGTAACAAGCACAGATTAATTGACTAAAAAT TGATTAAAATTGATGAAGTCATAGATTAAAATTGGTTTTCACCAACCCGAGTAACCCGACCCTACCCGAGGTCACCCGAA AGGTTGCGGGTTTGTAGACTTAAGAGAGTGTCACGGCCTAAAATTTTCTCAACCCGCACTGGTCGGGTAGGCTCAATTTT TCGGCTCAACCCTACCCTACCCGGCCGATTTACACCCCTA >DTA_3N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=865; TAGGGGTGTAAATCGGCCGGGTAGGGTAGGGTTGAGCCGAAAAATTGAGCCTACCCGACTAGTGCGGGTTGAGAAAATTT TGGGCCGCGACACTCTCTTAAGTCTACAAACCCGCAACCTTTCGGGTGACCTCGGGTAGGGTCGGGTTACTCGGGTTGGT GAAAACCAATTTTAATCTATGACTTCATCAATTTTAATCTAAGAGGCTCTTATATGCAAATAAATGATAAAATACTATTG TAGTAAATGAGCAATAAATGATATATGCAAATACTATTGTAGTAAATAATTACACAACAAAATTGCGGCATAATAAAATA TAAAGACTAATAACTCATATCACAATATGCATAAAGCAAGAGTGATCTCAAGGACCACATGATCACTTTTTAGTCAATTA ATCTGTGCTTGTTACATAAGAAATCATTATCAAACAGAACATGTTTTTCCTTCAATAGGGGGTCTAAATGCAAGGTGAAC AATTAAAACACTCACTTTGAAATCAAACACTTCCAATATAAATAAAGAATGTCCTAATTCAACAACTATGGCATACAAGC ATTTTTTACACAAATCGTGAATCCAAAACATAAATAAGTTAACAGTTTAAAAGCATAAAGTCCATAAACTTATGAAAGTA AGAATTTGAAGTGTTGAACATTGTTTTACCTACTTTGAACATGTTCGGCCGGGTAGGGTTACCTCGGGTTCATGTAACCC CACCCCGCGCCCCTACCCGCGCAGTGCGGGTTAGGTATAATTCAAACCGAAAATTAAATAAAAAATTAGAAACCCGTGAT TTTCGGGTAGGGTCGGCTCGGCTCGGCCGGGTTCGTCGGGTTCGGGGTGATTTCTTACAGCCCTA >DTH_3N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=135; AATTAGTGTCTAATCAATTATATCATGCCACGTCATGTAAAAAATTTAAATTGCTTTTTAACTAATTCTTTTGTACTTAT CATGAGATGATGTGGTATGATTTAATTAGTTAGACACTAATTAAGACACTAAAAA >DTH_3N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=194; TAAAGGACTCAAATCTTTTGTCTAATTTTGATGTCTTAATTGGTGTCTAACTAATTATATCATGTCACGTCATGTAAAAA ATTTAAATTACTTTTTAACTAATTTTTTTGTGCTTATTATGAGATGATGTGGTATGATTTAATTAGTTAGACACTAATTA AGACACTAAAAATTAGACAAAAAATCTGAATCCA >DTH_3N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=172; TTTGTTGTCTAATTTTTAGTGTCTTAATTGGTGTCTAACCAATTAAATCATACCACATCATTTCATGATAAGCACAAAAG AATTAGTTAAAAAGTAATCTAAATTTTTTACATGACGTGACATGATTTAATTGGTTAGACACTAATTAAGACACTAAAAT TAGACAACAGAT >DTH_3N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=118; TTGGTGTCTAACTAATTAAATCATACCACATCATCTCATGATAAGTACAAAAGAATTAGTTAAAAAACAATTTAAATTTT TTACATGACGTGACATGATATGATTGATTAGACACTAA >DTH_3N_5_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=116; ATGTCTAACAATTAAATCAACATTATATAAAAAATTTAAATTACTTTTTAACTAATTTTTTTGTGCTTATCATAATATGA TATGATTTGATTAGTTACATACTAATTGAGACACTA >DTM_3N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=272; GAGGAATTATTCAGTACACCGGGTGTACCACGTCATATTATTTATGTGGTACACCCGTCTAATGAGATTGTATCATTTAG ACATTTTGTCTATGTCAGCTTTTCACTTTTATTTTTCTCTTTCCTAATAGGTATTATTGAATACCTATTAAGAAAGAGAA AAATAAAAGTGAAAAACTTATTGGAAAAATGTCTAAATGATACAATCTCATTGGACGGGTGTACCACATAAATAATATGA CGTGGTACACCCGGTGTACTGAATAATTCCTC >DTM_3N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=286; GGAATTATTCAGTACACTGAGTGTATCACGTCATATTATTTATGTGGTACACCCGTCTAATGAGATTGTATTATTTAGAC ATTTTGTCTATAAGTCATTAAAATAAAGAAATTGAGTAGAATAATAAGTGCTTTTGACTCAATAATCAATACAAATACCT ATTAAGAAAGAGAAAAATAAAAGTGAAAAACTGACATAGACAATGTCTAAATGGTACAATCTCATTAGACGAGTGTACCA CATAAACAATATGACGTGATACACCCGGTGTACTGAATAATTCCTC >DTM_3N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=335; GAGGAATTATTCAATACACTAGGTGTATCACGTCATATTATTTATGTGGTACACTCATTTAATGAGATTATATTATTTAG ACATTTTATCTATGTCAGTTTTTCACTTTTATTTTTCTCTTTCTTAATAGGTATTTACATTGATTATTGAGTCAAAAGCA CTTATTATTCTACCTAATTTCTTTATTTTAATGACTTAACTTTAAAATTAAGCACAACTAAAAATAAAAGTAAAAAGTTG ACATAGACAAAATGTTTAAATAATATAATCTCATTAAACAAGTGTACCACATAAATAATATGACGTGATACATTTGGTGT ATTGAATAATTTATC >DTT_3N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=104; ATGGCTTTAACAGACTCAAAACGGGTCATATAATATTTCAAAATAAACATCTAGATCTTTATTTTGAAATATTATATGAC CCGTTTTGAGTCTGTTAAAGCCAT >DTT_3N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=84; AGACTCAAAACGGGTCATATAATATTTCAAAATAAACATCTAGATCTTTATTTTGAAATATTATATGACCCGTTTTGAGT CTGT >DTA_4N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=1072; TAGGGCTGGCAATTCGTGTTTGCGTGTCGTGTTCGGGCCGGCACGATTACGGCACGACACGATTATAGTGAACACGAACA CGACACGATTAATAAACGTGTCAGAAACCCAAACACGAACACGAAACGCTAATAACACGGTTAACACGACACGACACGCG AACACGATTACTAAACGTGCCGTGACGGGCCGACACGAAAAAAACACGTTTATGACCCGTTTATGACCCAACTAGCAAAA ATAGTGGAATTTTATATTGTATTCAAAACTATATTAATTGACTACTTAATATAAAATCATGCATAATAGCCAACACACAT TAAAATATCCAAATATCAAACACACACATATATATGATACTACTAGATTATCAAGTATATATGTTTCAAAACATACCAAT TACCAAACATCCAAAGAAGTTTGAAAACATAGCCAAGTACATTTAAATAAGTTTGAAAACATAACCAAACATTTGAATGT TTAAGTGCATAAAACATAAAATAAATATAGGAAAATGTCTTCTTTGAGCCTTGAGGTTGAATGCCCAACTACGCTCTAAA AACTAAAATTAGTTTCAAGAGACTGAGTCAGAAGTAGGGTTTTGTCTAATATATATATATATATATTGTCGGTTAGATAA AGTCTTTGTATTTGAATTTAAATAAAATAGAGGATAAATGGTTTATCATTAGAGATAAGGTTTCTTAGGTTAGAGTTTAT CTTTAATTAGGATAGTTTCTTTTAGGAAGATAAGGTTTCTTCCTTAGCCTATTTATTCTTATTTTTTACTATTCTGAAAA TAATAGAAGAGAGTTTCTTTCTAGAAAATTTACAACATATATATATATGGGCTTAATAAACGGGTCGGCGGGCCGTGTCG GCCCGATAACGGCCCGTATAACTAAACGGGTTAAGCGTGTTAAACGGGCTGGCACGAATCCAGCCCATTTATTTTCGTGT TATTCGTGTCAGCCCGTTAACGACCCAATTAATAATCGTGCGGTCCAAACCCATTTATCTCGTGTCGTTTTCGTATCGTT TCATCGTGTCGTGTCTGAAATTGCCGGCCCTA >DTA_4N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=965; CTGGCACGAATAACACGAAAATAAACGGGTTGGATTCGTGCCAGCCCGTTTAACACGCTTAACCCGTTTAGTTATACGGG CCATAATCGGGCCGACACGACACGACCCGAACCGACCCGTTTATTAATCCATATATATATATATATTTTTTTTAAGATAA AACCCTAGCTTCTCTAATTCTCTTTCTCTCATCTCTCTCATTCTCTCATTCTCTCACAGCCCGTTTTATTTATATTCTCT CATTTGCATGAAGGGTGTTTGATAAAAGGGTTAACTTAATTTAACACTCTAACTTTTAAATAAGTTATGGCATGTTGATA AAATTACAAAATGCCAATGGATTTGTAGATGGATGATTTGTAGATGGACTTGTAGATGGTTGATTACAAAATGCCAATGG ATGATTTGTAATGGATAAACCTAAACTTTAAATATGTTTTATGCTTTATGCACTTAAATATGCCAATGGACTTGTAGATG GTTGATTATGTTTTATGCACTTAAATTTTCAAATATTTGGTTATGTTTTCAAACTTATTTAAATGTACTTGGTTATGTTT TCAAACTTCTTTAGATGTTTAGTAATTGGTATGTTTTGAAACATATGTCATAAGTGATGTTTTAGATATTTTAATGTGTG TTGGCTATTATGCATGATTTTAACTATAAGTGATATTAAGTAGTCAATTAATATAGTTTTGAATACAATATAAAATTCAC TATTTTTGCTAGTTGGGTCATAAACGGGTCATAAACGTGTTTTTTTCGTGTCGGCCCGTCACGGCACGTTTAATAATCGT GTTCGCGTGTCGTGTCGTGTTAACCGTGTTATTAGCGTGTCGTGTTCGTGTTTGGGTTTCTGACACGTTTATTAATCGTG TCGTGTTCGTGCTCACTATAATCGTGTCGTGCCGTAATCGTGTCGGCCCGAACACGGCCCGCGAACACGAATTGCCAGCC CTACT >DTH_4N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=109; ACAACTCAAGTCATAACTCAAGTTTTTTATGTGAGAGAAAAATACTGTAATAAAAAAGTTAAATTTAAATTTTTGTGAGA GAAAACACTGTAGTAATATAACTTGAGTT >DTH_4N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=141; TCACAACTCAAGTCACAACTCAAGTTTTATTGTTACAGTATTTTCTCTCATAAAAATTTAAATTTAACTTTTTTATTACA GTATTTTTCTCTCACATACACAACTCAAGTCATAACTCAAGTTATGACTTGAGTTGTGAAA >DTH_4N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=126; TCACAACTCAAGTTAAGAACTTGAGTTGTGTATGTGAGAGAAAAACACTGTAGCAAAAAAGTTGAATTTGAATTTTTGTG AGAGAAAACACTGTAGCAATAGAACTTGAGTTGTGAAAAAAACAAG >DTH_4N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=153; TATGTTTGTTTCACAACTCAAGTTAAGAACTTGAGTTGTGTATGTGAGAGAAAAATATTGTAGTAAAAAAGTTAAATTTA AATTTTTATGAGAGAAAATACTGTAATAATAAAACTTGAATTGTGACTTGAGTTGTGAAAAGAACAAGACCTT >DTH_4N_5_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=136; ATGTTCTTTTCACAACTCGAATCACAACTCAAATTTTTTGCTACAGTGTTTTCTCTCATAAAAATTCAAATTTAACTTTT TTACTATAGTATTTTTTCTCACATAAAATTCACTTTTCAACTCAAGTTCTCAATCA >DTH_4N_6_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=106; AGAACTTGAGTTAAAAAGTGAATTCATGTGAGAGAAAATATTGTAACAGAAAAAGTTGAATTTGAATTTTTATGAGAGAA AATACTGTAATAAAAACTTGAGTTGT >DTT_4N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=204; ATGCTAGGGACACCAACTCAAATCTCAACTTTTGTATACCAACTGATGTGACATGTGAGTTGTCATTTTTATATTGGTGG GTGTTTAAAATATTGTCACGTCAATTAATGATAAGAGATTACATCTACCAATAAAAAGATGACAACTCACATGCCACATC AGTTGGTACACAAAAATTGAGATTTGAGTTGGTGTCCCTAACAT >DTT_4N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=244; TAATTTAAATTTTTAATAATAATTAAAAAATATAAAATAATAATAATGCTAGGGACACCAACTCAAATCTCAATTTTTGT GTATTAATTGATGTGGCATGTGAGTTGTCATTTTTATATTAGTGGGTGTTTAAAATATTGTCACGTCAATTAATGAAAGA GATTACATCTACTAATAAAAAAATGACAACTCACATGCCACATCAATTGGTACACAAAAATTAAAATTTGAGTTGGTGTC CCTA >DTH_5N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=168; CTCTGGTGTTCTTTCTTTTTTAAAAACACTGGTGTTCTCTGTTTATCAGCCGTCAGATCTGTATTAAATCTGGTCAAAAG TCAAATCAGATTGAAAAAATAATACAAATCTGACGGCTGATAAGCAGGAAACACCAATGTTCTCAAAAAAGAGAGAACAC CAGAGAAA >DTH_5N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=161; TTAGAAACTTTCTCTGGTGTTTTTTCTTTTTTAAGAACACCGGTGTTTCTTACTTATCAGTCGTCAGATCTGTATTAAAT CTGATCAAAAGTCAAATCAGATTGAAAAAATAATACAGATCTGACGGTTGATAAGCAGAAAACACCAGTATTTTTAAAAA A >DTT_5N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=634; GAAAATAGGCCAATATGAAAAGTTTAAGAAAGTATATAGGCCAATTTTTAGTTATAGAAATTAATAGGCCATAACTTGTC AAGTTATGGTTCATAACCAGATAAGTTATGGACAAACTTGTCAAGTTATGGTTCATAGCCAGACAAGTTATGGACAAAAA CTGTGATTATGGACAATAACTTGTCAAGTTATGGTTCATAACCAGACAAGTTATGAACGAAAATAGTAATTTGGCCTATT TATTAACTTATGTAAACTATTGGCCTATTAATTTTAATTCATCTCAAGTCTTGGCCTATTTCCCTCTTTCTCCCTTAAAT TTTTTTAAGGGAGAAAGAGGGAAATAGGCCAAGACTTGAGATGAATTAAAATTAATAGGCCAATAGTTTACATAAGTTAA TAAATAGGCCAAATTACTGTTTTCGTCCATAACTTGTCTGGTTATGAACCATAACTTGACAAGTTATTCTCAATTTTTGT CCATAACTTGTCTGGCTATGAACCATAACTTGACAAGTTTGTCCATAACTTATCTGGTTATGAACCATAACTTGACAAGT TATGGCCTATTAATTTCTATAACTAAAAATTGGCCTATATACTTTCTTAAGCTTTTCATATTGGCCTATTTTCT >DTT_5N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=324; AGAGGGAAATAGGCCAAGACTTGAGATGAATTAAAATTAATAGGCCAATAGTTTACATAAGTTAATAAATAGGCCAAATT ACTGTTTTCGTCCATAACTTGTCTGGTTATGAACCATAACTTGACAAGTTATTGTCCATAATTCACGGTTTTTGTCCATA ACTTGTCTGGCTATGAACCATAACTTGACAAGTTTGTCCATAACTTATCTGGTTATGAACCATAACTTGACAAGTTATGG CCTATTAATTTCTATAACTAAAAATTGGCCTATATACTTTCTTAAGCTTTTCATATTGGCCTATTTTCTACTATTTCCGT TTAT >DTH_6N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=357; TAATGTTAGGATCCGTTAATGACTTGGGAACTTGTTTGGTTAGTGGGCTGGTAGAGTTAGTAGGAATTAGTATAAATAAA GGGCTTAGTAGCTCACTAGAGGTAGGCTGTGATTTTGAGAGTTTTGGGAGACTGAGATTAGGGAGAGCTGGTGGTCTCTC GAATACCATCAAAGTTAGGAGTTCTCCGGAGTCCTCGAATACTCCAGTCTATCCTAAGCTTTCTTTACGTTTTTCTTAGT TTGGTTGTAAAATTCTATGAGCTAGTGTTGGTGATGATCAATAAAACTACTCTGATTGCCTTCTATTCTTGTTCTTCTGT GTGAATATTGAGCTGTGAGAATCAGGTTCCTAACAAT >DTH_6N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=350; TTGTTAGGATCCTAGCTCAGAAAATCAGCCAAACACCAATACCACACTCACACACACCAGAAACAGCAAGAAAATGAGAA TAATTGGAGGGAATTTTATTAATCTAATCAGCCAAGAACACCAAATTACACTGAAATGTAAAGGATAGAACGGAGAATTC GAGTACTCCGGGAACTCCTAATTTAGTGGTATTCGAGAGACCACCGCTCTCCCTAATCTCAGTTTCTCAAAACTCTCCAA ATCACAACATACCTCTAGTGAGCTACTAAGCCCTTTATTTATACTAATTCCTACTAACTATACCAGCCCACTAACCAAAC AAGTTCCCAAGTCATTAACGGATCCTAACA >DTH_7N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=471; CAGTGTGTTTGGTATGAATGAAAAGTGGAAGGAAAGAAAATGTTGGAGGGATTTTGGGATGGAAATTGAGAAGTTAGCTT GTTTGGTAGAAAGGAAATTGTGAAGGAAAGGAAAATTGAATGGAAATTTTTATTGGTGGGTCCCACCATATTCAATCCCT CCAAAAGTGGGTGGATTTTAGGAAGAAAAATATGGATAACTACACAAATGAAGTCAAATTACTGAATTGTCCTCATTTTT CATCCAAAATTGTCCTCATTTGGGCAAAAAAGTAATTACACCAATAATAATTTTTTCATCCCTTTAGTTTCACTTCCAAT ACCAAACAAGGGAAGGTAGATTCATTTTCTTTCTTCCCTATCATACCAAACAAGTCAAGAGAAAATCAAAATCTTTTCTA TCATTCTAATTTTCTATGCATTATAGTTTTCCTTTCCCTCCCATTTTCTTTCCTTCTTACCAAACAGAGTG >DTH_7N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=455; ATGTTTGGTAGGAAGGAAAGAAAATATGATAGAAAGAAAATATGGAAGTGATGGAAAATAGCAATGATGGAAAGGAAATT GATTTTCTTTTATGTTGTTTGGTATGAGAAGATGGAAAGAAAATGAGCTTACCTTCACTTGTTTGGTATTGGAAGTTAAA TTGGGAGGAAAGAAAAAATCTTACTCGTAAATTACTTTTATACCCTTAAATTTTTTGCTTGGATGTTGATGGAGAAAATG GTAGTTTAGTAACTTTGCTCACTTTAATGAGTTGTCCCCATTTTCTGCCCACTTGTGGAAAGAAAAAAAATGGTGGGGCC CACATGTATTATTTTTCACTCTATTTTCTCTTCCTTTCTCTTTTCTCTCCTACCAAACAACCTACATTTTCATTTTCCCT CCCAAAATCCCTCCACCTTCTTCCTTCCTTCTACTTTTCTTTCCTACCAAACATA >DTH_7N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=424; GCCATATTACACTCCGTTTGGTAGGAGGGAAAGAAAAGAGAATGGAAAGAAAACACATAAAAGAAAGAAAATGTGAAGGA AATGAATGAAGTTGATTTTCCTTTATAGTGTTTGGTATAATGAGAGGAAAGAAAACATGTAATAGCCTAAATGACTATTT TATCAATTGTTTAATATTAATTTAGATTTTAAAATAGGGACACAAAAGTAAATTTAGCCATCAATGAGTGGATTTGAGTT TTCCTTCCAATGTTGGAGAGATAAAAAATAGTGGCCCCACCATAATTTTTTTCCATCATATTTTCCTTTCTCTCCTCTCT TCCTTCTTACCAAACAACCAACTCTATCATTTTCCATCCAATAATCCCTCTACTTACTTCCTTCCTTCCACTTTTCCATC ATACCAAACACACTCTTAATGTTT >DTH_7N_4_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=399; GTGTTTGGTAGGGTGGAAAAGAGAGAGGAAAGAAAATAGAGGAAGGATTTTGTAGAGGAAAATGGAATTTTAGGTTGTTT GGTAGAGAGGAAATGAGGAAGGAAGGAAAATGAAAATCCATGGGGCCCACCAATTTTTAATCCTTCCAACTTTGGGAAGA AAAGAGGAGGGAAAAAGTTTGACAAAAAAATGAGATGTAAAATAACAATTTTAACCTTCACCATTCATCATATTTTTATT TGTATTGGGGTATTATTGTAAAATGCCTTAAATTTGACATTTTCTTTTCACTTTTCTTTCTCTTCTACCAAACAACATGA GAGAAAACCATTTTACTTCCTTCACCTAGGTATTTTACTTCTCTTTCCTTCCTCTTTTCTATCCATCCTACCAAACATA >DTH_8N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=528; GAGGCGTTTGGTATGGAGTAATCTTTAAGTGGGAATGAAAATCTTCACATATTACTATGTTTGGTACAAGAGTTGTGATT TTTATATTTCCAGGAATATCAATCCCATGGGATTCATTTTACCCTAAAATGGGGTAATCTGAATAACACCCAATATGGTG TTATTCAGATTCCCAGGAATATCAATATGGTGTTTTACCCGTTTGTAATATATTCTTAAAATTTGTTAAGATTTTTTTTG AAGAACAACTTACAAATTTATTTCTTAAACTAAGAAGAATTTTTGTGTTTCTTAAGAATAATCAAATTTTTAGTACTTAA AATATTTTAAATTAGTTATTATTAAGAAGAAATACATTACATTACTTTGTATCAACCAAACACAATAAAATAATTTTCCT GAGAATATGAGAAAAGATTCACATGCATAACCAAACGTGGTAATACACATTTCCTAAGAATCATATTCCCTTCTATCACT TTTTCAGTAATATGATTCTTGCCCATTACCGCATACCAAATGCCCCCT >DTH_8N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=415; AGGGGGCGTTTGGTATGCGGGAATCAGTAGGAATCATATTCTCAGGAAAGTGATGGAGGGTAATATGATTCCTAGGAATA ATACATTACTGTGTTTGGTTCCATACATGAATCTTTTTCAAATTCTCAGGAATATTACATTACTGTGTTTGGTTGTTCGC ATGGAAGAAGATCCATAATAATAATAATAATAATAATATAATAATAATAATAATAAGATTCCCATGATTTTGAGATTCCT GAGAATTTGAATAACACCATGTTGGGTGGTATTCAAATTACCTTAAAATGAGGGAAAGTGAATCCCATGGTAATCACTTT CTTGGGAATCTAAAAATTATAATTCTTGTACCAAACATGGTAATATTGCAGATTCTCATTCTCATCCTTAAGATTACTGC ATACCAAACGCCCCC >DTH_9N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=97; CCGGTAGGTTAAGTTTTTTTAACCGTTAGATCTGCGTATTTTTTAACTTTTACGTGATTTTATGCAGATTTAACAGACAA AAAACTTAACCTACCGG >DTH_9N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=157; TAATAAGGGACCTTCTCTGGTACGCTAACATACCGGTAGGTTAAGTTTTTTATCCGTTAGATCTGCATAAAATCACGTAA AAGTCAAAAAATACGCAGATCTAACGGTTAAAAAAACTTGACCTATCGGTACGCCAGGCGTACCAGAGAATCTCTCT >DTH_9N_3_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=119; CGTCTGACGTATCGGTAGGTCAAGTTTTTTTAACCGTTAAATCTGTGTACTTTTTAATTTTTACGTGATTTTATACAGAT CTAACGGACAAAAAACTTAACCTACCGATATATTAGCGT >DTH_10N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=328; GGTTGCGTTTGGTATGAGGGTTCAAATCAGGGTGGTTTTAATTTTAGAACTAGAACCATGATTTATGATTTGAACTTGTG GTCCAAACCATAGTTCTGGAACCGGAATCAGAACCAGAGGTTTGAACCATCCAAAATCAAGGGGGGAGGTGGTTTTATTT TTTGGGGTGGTTTTGGTTTAAAACATCACATCAGGATTCAAACCTTGAACCAGAACCATCCAAACCAAACACTGATTTTC AAGAACCATTTTTTACTTTTTGCAAACAAACAAAGGTTTGAACCAGAATCATGGTTCCGGTTCTAGAACCCTCATACCAA ACGCAACC >DTH_10N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=320; TGTTTGGTATAAGGGTTCTAGAACCCGGAATCATGATTCTGGTTCAAATCAGTGTTTGTTTACAAAAAGTAAAAAGTGGT TCTGATTTGACTCACACAGAATCAGTGTTTGGTTTGGATGGTTCTGATTCAAGGTTTGAACCCTGATGTGATGTTTTAAA CCAGAATCACCCCTGATTCTAAAACCACCCCCCCTTGGTTTTGGGTGGTTCAAACCCCTGATTCTGGTTCTGGTTTCAGA ACCATGATTTGGACCCAAAATCATGAATCATGGTTCTGGTTCTAAAATCAAAACTAGAATCACCCTGGTTTGAACCCTCA >DTH_11N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=860; TGACATGTTTACTTATCCGTAATTAGAGTGGACATGAATCGGAGTGGACAGGAATCGGAGTCAGAATAAGCTGTTTACTT AGGTTTCAGGAATCAGAGTCGGAATCAGTCTCAATCTCATTCATGCGTTTACTTACACCCAGAATCGGAATAAACTGTTA TAAATTTACTTACCTACCCTTTTAGTAGATTTTTGTGTGTTGAACTTTAAAAAAAAATTGTATATTATGCTAACTATCTT AATATTAAGATAACTAATTAGTAATTAGATTTTTTTAATCACACCTAAATTTTTTTTAATTAGTAATTAGAAATTGTAAT GGTCTGGATCTCCACGAATCCTTGAAATGATGTTGTGCAATCAAGGGGCAAAACATGGTTTGATCACAGATTCAACAAAT AAACACAAAAAAAAAAAATAAAAAAATAAACTTGCGATTCAATAAAAAAGAACCACAGTGATTTATGTTATTGACTCACC TTGAAGAGAAGAGGGATGCTCTTGGTTGTTGTGGATGCAATGCTGTGTTTTGAGGAGAAGAAAATATCAGAGGAAGTGAG CAAGGAGATACGAGAGGCGTGAAAGTAAATTAGGACATTTTTAATTTTTTACTTTTTACTTTTCTATTCACAAATTTGTT AGTAGAATTAAGGGTAAAATCGTAATTCACATTTACTATCAGGATTGAGAGTGCCAATCCGGTGGGGGGTGGGGGGAGTG TCAATCCCATTCCTCAACCCCAAATTGGTGTGGGACCCACACATTCTCACTCTCATTCTAAGATAAAAATGGATAAGTAA ACATGAGGTTGATTCCGATTCTCAATTCTCATTCCCCACTCCTGATAAGTAAACATGTCA >DTH_11N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=929; TGGCATGTTTACTTATCCGTAATCGGAGTGGACATGAATCGGAGTGGACAAGATTCAGAGTGGACAGGAATCAGAGTCAG AATAAGCTGTTTACTTAGGTTTCAGGAATCGGAGTCGGAATCAGTCCCAATCTCATTCATGCGTTTACTTACGCCCAGAA TCGGAATAAACTGTTATAAATTTACTTACCTACCCTTTTAGTAGATTTTTGTGTGTTGAACTTAAAAAAAAAGAAATTGT ATATTATGCTAACTATCTTAATATTAGGATAACTAATTAGTAATTAGATTTTTTTAATCACACCTAATTAATCATCTAAA TTAGGATAACTAATTAGTAATTAGATTTTGTTAATTACTCTCTTCTTTCGTGCTAAAAGTTGAGACATGGTTACTCTACA TTATCAACATATAAAATTAGATTTAGCATTGCATTGCATATTATAGAAAACAAAAATCAGCTTAGGATATAGATTGAAAA ATGAAAAGCAATAGGCATAACACAAGAATCAAATTATAAGCATGAAAAAAAAACTATCTTAGTTTCATTTAATTATTTGC ATTGATATGAATTCGTCCATGGCACTAGTAAGAAAGAAAGAAAAGAAAAAAAATATCAGAGGAAGTGAGCAAGGAGATAC GAGAGGCGTGAAAGTAAATTAGGGCATTTTTCAATTTTTTACTTTTTACTTTTCTATTCACAAATTTGTTAGTAGAATTA AGGGTAAAATCGTAATTAATATTTACTATTAGGATTGGGAGTGCCAATCCGGTGGGGGTGAGAGGAGTGCCAATCTCATT CCTCAACCCTAAATTGGTGTGAGACCCACACATTTTCACTCTCATTCCAAGATAAAAATGGGTAAGTAAACATGAGGTTG ATTCTGATTCTCAATTCTCATTCCCCACTCCTGATAAGTAAACATGCCA >DTH_12N_1_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=353; ATTGTCTCTGGTCAGGCACTTGGAAAGTGCCTGACCGGAACGGCAGTTGTATAATTCTGCATAAATTGTGTATATTTACA TGTAAATCGTGTATATTTACATGTAAAGTCGTGTATGTTAAGTTATAAGAAACGACAATGTATATTAATCCTCAAAACAT GTATTTTTTATAGCAATTAGTGAACACATAGCATGAAAATATGTATATTGGCTGATTTGTTGTATTTCATGTTAAATATA CACGAATTACATGTAAATATACACGATTTACATGTAAATATACACAATTTATGTAGAAATATACAACTGCCGTTCCGGTC AGGCACTTTCCAAGTGCCTGACCGGAGACATTA >DTH_12N_2_Mno Class=DNA transposons;Order=MITE;superfamily=MITE;length=458; TATATATAGGCAAGGTCTCTGGTCAGGCACTTGGAAAATGCCTGACCAGAACGGCACTTGTATATTTTTGTATAAAGTGT GTATATTTACAGTAAGTTGTGTATATTCACACGTAAGTTGTGTATATTTACATGACACTTGTATAATTGTGCAATCGTGT ATATTAACATGTAAATCGTGTATATTTACATATAAATCATGTATGTTAAGTTATAAGAAATGACAATGTATATTAATCCT CAAAACATGTTTTTTTTATAGCAATTAGTGAACACATAGCATGAAAATATGTATATTGACTGATTTATTGTATTTCATGT TAAATATACATGACTTTACATGTAAATATACATGATTTACGTATAAATATACACAATTTATACACGATTATACAAGTGCC TGACTGGTCAGGCACTTTCCAAGTGCCTGACCAGAGACAATTCCTATATATATATATA