Mulberry Horizontal Gene Transfers

The small RNA sequenced data of three silkworm tissues (hemolymph, anterior-middle silk gland and posterior silk gland) were used as queries to search against mulberry predicted microRNAs and five predicted mulberry miRNAs existed in the silkworm.

Tissue 1st sequencing 2nd sequencing Name Sequence Ref miRNA
Serial number Reads Serial number Reads
hemolymph t0016771 5 t0014885 3 MIR166f UCUCGGACCAGGCUUCAUUCC bdi-miR166f
hemolymph t0055412 2 t0005325 11 MIR166i UCGGACCAGGCUUCAUUCCCC ptc-miR166i
anterior-middle silk gland t0088756 6 - - MIR156a UGACAGAAGAGAGUGAGCAC ath-miR156a
anterior-middle silk gland t0102487 5 - - MIR157a UUGACAGAAGAUAGAGAGCAC ath-miR157a
posterior silk gland t0093024 4 - - MIR157a UUGACAGAAGAUAGAGAGCAC ath-miR157a